Answer: Viruses are infectious agents with both living and nonliving characteristics. Living characteristics of viruses include the ability to reproduce – but only in living host cells – and the ability to mutate.
Explanation:
googles word not mines, but put it in your own.
Answer:
Mouth, stomach, liver, pancreas and small intestine.
Explanation:
If we eat these foods which have carbohydrates, its digestion starts from the mouth because the saliva present in the mouth mixes with the food and start its digestion. When the food reaches to the stomach, the foods are broken down into micromolecules with the help of enzymes secreted by liver and pancreas. After that the food goes to the small intestine where absorption of nutrients and water also occurs.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Consumers. The consumers would spray on the fruit before eating it to enhance it's flavor.
