1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viktelen [127]
3 years ago
10

The speed of light in a vacuum is approximately 299,500,000 meters per second. In scientific notation, we can write this number

as a × 10b where a = and b = .
Biology
2 answers:
Whitepunk [10]3 years ago
8 0
6.022 x 10^<span>23
 a = 6.022
b = 23</span>
Nonamiya [84]3 years ago
6 0
In scientific notation, the value of the speed of light in a vacuum
 will be written as 2.995 * 10^8. When this value is represented in the form of
 a * 10^b, then, a = 2.995 and b = 8.
The value of the speed of light in a vacuum given above can also be rounded up to approximately 300000000. In this case, the scientific notation will be written as 3 *10^8.
You might be interested in
Select all that apply The cellular respiration the mitochondrion serves as?
SVEN [57.7K]
D. The Krebs cycle

Here’s the Explanation for it:

The Cellular respiration refers to the biochemical pathway in which the cells release energy from chemical bonds of food molecules. The energy that is provided is very important to the creation of life itself.

The aerobic phases of the cellular respiration in eukaryote is seen within mitochondria (organelles). This is know as the Krebs Cycle and the electron transport chain which are aerobic phases.

Hope this helps!
5 0
3 years ago
Is xylem a cell or a tissue or something else?!?
ryzh [129]

Answer:

Explanation:

tissue in vascular plants.

4 0
3 years ago
Read 2 more answers
PLEASE HELP QUICK!!!
svetlana [45]

Answer:

I believe the answer is C) Carbohydrate

Explanation:

Sugar gives you fast energy, and it is not long term like a lipid, so the answer is C.

6 0
3 years ago
Drag each label to the correct location on the image.
Darina [25.2K]

Answer:

1)herds young in to center of group

2)produces many

offspring at once to

protect against high

predation  risk

3)protects offspring

until environmental

conditions are ideal

for growth

Explanation:

3 0
3 years ago
Read 2 more answers
18. Does the blood of the mother and the baby ever mix?
Art [367]

Answer:   No

Explanation: Usually a mother and baby's blood do not mix while the baby is in the womb. The mother's blood runs alongside the placenta, and the nutrients needed by the baby are absorbed and transferred to him/her.

6 0
2 years ago
Read 2 more answers
Other questions:
  • Compare the manner in which grasshopper hears to the way a human hears
    8·1 answer
  • Which of the following is an example of species diversity?
    7·1 answer
  • All BUT one action will help increase the accuracy of a scientific experiment. It is
    8·1 answer
  • How is stomach acid neutralized in the small intestine
    14·1 answer
  • The dna content of a cell can be measured using a fluorescent dye. based on the table below, at what point in the cell cycle doe
    11·1 answer
  • Is species singular or plural?
    5·1 answer
  • What happens when sand and gravel are whirled around by eddies in a river?
    9·1 answer
  • Which substance is a fuel used in nuclear power plants?
    8·1 answer
  • HELP NEED ASAP!!!!! GRADES R GOING IN PLEASE HELP ME!!!!!
    6·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!