1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanzania [10]
3 years ago
5

What may a salesperson say when you enter a store?

Biology
2 answers:
muminat3 years ago
7 0

Answer : Option D) en que puedo servirle


Explanation : Anytime if someone enters into a store the sales person always asks for the requirement of the customer's demand in spanish it will be en que puedo servirle. It is a good gesture for gaining more customer satisfaction of a particular store.

WINSTONCH [101]3 years ago
3 0
"en que puedo servirle" is the one among the following choices given in the question that a <span> salesperson might say when you enter a store. The correct option among all the options that are given in the question is the fourth option or option "D". I hope that this is the answer that has come to your great help.</span>
You might be interested in
The hypothalamus controls secretion by the anterior pituitary by
VARVARA [1.3K]
The pituitary gland is often called the "main gland" of the body, as it regulates many of the activities of the endocrine glands. ... HET (thyroid stimulating hormone) stimulates the thyroid gland to release T3 and T4 to stimulate metabolism in other cells of the body.
4 0
2 years ago
What are the negative consequences of improper disposal of electronic waste?​
Gre4nikov [31]

Answer:

1) Increased probability of hazardous chemical contamination.

2) Air, water, and soil pollution.

3) Mortality in both terrestrial and aquatic organisms.

4) Development of diseases in humans.

Explanation:

The improper disposal of electronic waste can have detrimental consequences for the environment and, as a result, to all living beings including humans.

If electronic waste is thrown away in an open area, it warms up and releases hazardous chemicals that are detrimental for the health of living beings. This occurs because <u>electronic objects contain toxic chemicals such as lead, mercury, cadmium, amongst others</u>.

These chemicals will eventually enter both soil and water, harming thousands to millions of terrestrial and aquatic organisms. Moreover, these chemicals will enter the food chain and, as humans consume these affected organisms, we are also affected in numerous ways. For example, ingesting these chemicals could cause reproductive issues, damage to both the nervous and digestive systems, the development of cancer, etc.

4 0
3 years ago
The electric signal for a contraction passes rapidly from one heart muscle cell to the next by way of
malfutka [58]

Answer;

-Gap junctions

Explanation;

-Gap junctions are a specialized intercellular connection between a multitude of animal cell-types. they are organized collections of protein channels in cell membranes that allows ions and small molecules to pass between adjacent cells.

-Gap junctions allow the exchange of ions, second messengers, and small metabolites between adjacent cells and are formed by two unrelated protein families, the pannexins and connexins.

4 0
2 years ago
Dna partially unwinds as the hydrogen bonds between complementary bases are broken. the enzyme responsible for this is:
Rudiy27

The enzyme responsible for that is DNA helicase.

7 0
3 years ago
Lassandra takes a sip of cola. "sweet...Cold, wet, tingly...Slightly bitter," she reports. Lassandra is:
Mama L [17]

In the given case, Lassandra is introspecting.  

The examination of one's own feelings and conscious thoughts is known as introspection. The procedure of introspection depends entirely on the observation of one's mental condition, while in spiritual perspective it may signify towards the test of one's soul.  

Introspection can be a procedure of examination, healthy self-reflection, and exploration that is good for one's brain and well-being.  


8 0
3 years ago
Other questions:
  • What would most likely happen to a unicellular organism if it was exposed to a hypotonic solution for an extended period of time
    13·2 answers
  • what canyon exists where an ancient river once flowed. briefly discuss how the hydrosphere and atmosphere have carved this canyo
    12·1 answer
  • Define the term active transport
    8·1 answer
  • Why does the warmest daily temperature occur in mid-to-late afternoon
    10·1 answer
  • Define each of the following terms and explain how each of them can benefit the plant.
    15·2 answers
  • Changes in DNA that sometimes do and sometimes don't have a harmful effect are called what?
    14·2 answers
  • 4. Which system produces gametes?<br>reproductive<br>respiratory<br>endocrine<br>circulatory​
    14·2 answers
  • गृहकार्य वर्तमान काल, भूतकाल र भविष्य कालको ५ ५ वटा वाक्य बनाउनुहोस​
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Structure and Properties of Matter:Question 4
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!