Name three common type of valve abnormalities?

2 answers:

6 0

There are several types of valve disease: Valvular stenosis. All four valves can be stenotic (hardened, restricting blood flow); the conditions are called tricuspid stenosis, pulmonic stenosis, mitral stenosis or aortic stenosis. Valvular insufficiency.

velikii [3]3 years ago

5 0

<h2>Answer and Explanation </h2>

The heart made up of four valves that is tricuspid, pulmonary, mitral and aorta. The three major valve abnormalities are as follows :

Disturbance in the blood supply to the heart.

Oxygen supply to the heart.

Narrowing of the arteries.

The valve abnormalities should be treated as soon as possible otherwise it will be life-threatening for them and can be a reason of heart attack and strokes.

You might be interested in

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved