1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
horsena [70]
3 years ago
15

In both men and women, bone mass peaks between the ages of 25 and ____.

Biology
1 answer:
Ksenya-84 [330]3 years ago
4 0
Peaks between the ages of 25 and 35
You might be interested in
When making a U-turn at an intersection, you should begin the maneuver __________ .
mezya [45]
C is correct

A is incorrect because the far right lane of the road is NEVER a U-turn lane unless you can drive on the sidewalk legally (you can't)

B is incorrect it is not always the lane next to the center lane
4 0
2 years ago
Which of the following does NOT cause weathering?
TiliK225 [7]

Answer:C

Explanation:

7 0
3 years ago
Haploid cells are the product of...
Wewaii [24]

Answer:

Meiosis

Explanation:

Because meiosis is a reduction division

5 0
3 years ago
51-54. Ibigay ang apat na prinsipyong nakapaloob sa pilosopiyang<br>Mandate of Heaven.​
Svetlanka [38]

Answer:

1) Ibinibigay ng langit sa emperador ang karapatang mamuno,

2) Dahil mayroon lamang isang Langit, maaari lamang magkaroon ng isang emperor sa anumang naibigay na oras,

3) Ang kabutihan ng emperador ay tumutukoy sa kanyang karapatang mamuno, at,

4) Walang isang dinastiya ang may permanenteng karapatang mamuno.

Explanation:

5 0
2 years ago
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
2 years ago
Other questions:
  • How does weathering and erosion effect Earths surface?
    8·1 answer
  • Which hormone has the most influence on a safe pregnancy?
    6·2 answers
  • A cell nucleus if often referred to as the
    14·1 answer
  • Which of the following is an example of the endocrine system maintaining homeostasis? Detecting a pain stimulus and sending a si
    7·1 answer
  • What is Wiesel arguing in his Nobel Prize acceptance speech?
    7·1 answer
  • How are atoms formed? descibe on your own words.
    12·1 answer
  • What is the diference between the axial and appendicular skeleton
    5·1 answer
  • Complete the sentence by selecting the correct answer. Darwin's idea of evolution suggested that…
    11·1 answer
  • On Which ends is the phosphate group on a nucleotide
    12·1 answer
  • What term is applied when two genes fail to assort independently, that is, they tend to segregate together during gamete formati
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!