1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DedPeter [7]
3 years ago
6

This is a trait that can be seen in an individual

Biology
1 answer:
Advocard [28]3 years ago
7 0
The phenotype is the type of trait that can be physically observed in an individual. Examples include hair colour, eye colour or height.
You might be interested in
The heat absorbed/added to the material causes the material to change its form from?
DerKrebs [107]

Answer:

It can, but each material has a different amount of heat it needs in order to change it’s form.

Explanation:

For example, If you heat water, it will go from the liquid stage to the gaseous stage. It will turn into vapour. So it is changing the form of said material.

This change is mainly due to the breakdown of molecules and chains which enable reactions to happen when heat is applied, since it changes those bonds between molecules.

4 0
3 years ago
A database speeds up the sharing of scientific knowledge by:
saul85 [17]

by assembling large amounts of information in a single location

3 0
3 years ago
Read 2 more answers
Hurry 30 Points! I need help!​
pogonyaev

Answer:

We need the directions. Once provided I will then edit this.

Explanation:

6 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
What trait most likely helped young angiosperms in this way? plez help
andrezito [222]

Answer:

Vascular Tissues

Explanation:

Angiosperms higher flowering plants it is most diverse group in a plant kingdom nearly 300,000 species of flowering plants are found under this kingdom.The angiosperms have specialised cells and tissues that carry out their metabolic functions and evolved vascular tissues (xylem and phloem) that translocate the water and nutrient to all parts of the plant. They are terrestrial, root system absorbs water and mineral from the soil. the shoot system supports and leaves involved in the process of photosynthesis

4 0
3 years ago
Read 2 more answers
Other questions:
  • BIO 10 URGENT PLEASE
    9·1 answer
  • T cells are subdivided into many types, each of which has a particular function in the response to a pathogen. match the t-cell
    13·1 answer
  • Which is one way that analyzing ice benefits scientists who study ancient climates?
    5·1 answer
  • Which word parts do you need to build a medical word that means​ "process of making an incision​ (into the) kidney​ (to remove​
    9·1 answer
  • Which of the following structures is not a component of a photosystem?
    7·1 answer
  • Squirrels and other small mammals near Arizona's Grand Canyon are shown to have experienced speciation. Two populations of antel
    6·1 answer
  • Amoebic dysentery is NOT transmitted by
    13·2 answers
  • Explain the light dependent and light Independent reaction s of photosynthesis
    6·1 answer
  • Which enzyme functions to prevent supercoiling of the DNA molecule during replication?
    5·2 answers
  • If a promoter is found within a nucleosome, how would it be possible to express that gene if needed?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!