The condition in which the body immune system is completely failed to resist any sort of pathogen is called AIDS.
Our immune system is consist of cells proteins and organs which are involve in our immune system. When any component is failed to perform it’s function then it leads to AIDS.
AIDS refers to the last stage of destruction of lymphocytes.
The causual agent for aids is HIV(human immuno deficiency virus).
Much of the coordination of vertebrate body functions via chemical signals is accomplished by the endocrine system.
The endocrine system is an information system composed of hormonal feedback loops that are secreted directly into the circulatory system by the body's endocrine glands and regulate distant target organs.
In vertebrates, the hypothalamus is the centre of neuromodulation of all endocrine systems. The main endocrine glands in humans are the thyroid and adrenal glands.
The study of the endocrine system and its disorders is called endocrinology.
The glands that send signals to each other in sequence are often referred to as the hypothalamic-pituitary-adrenal axis.
In addition to the specialized endocrine organs mentioned above, many other organs that are part of other body systems have secondary endocrine functions such as bones, kidneys, liver, heart and gonads.
For example, the kidneys secrete the endocrine hormone erythropoietin. Hormones are amino acid complexes, steroids, eicosanoids, leukotrienes, or prostaglandins.
Learn more about endocrine system here : brainly.com/question/1223158
#SPJ4
Answer:
Your answer should be D. A section of DNA that codes for a specific trait.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
