1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Damm [24]
3 years ago
12

What type of bonds holds together the sugar phosphate backbone

Biology
2 answers:
Lilit [14]3 years ago
7 0
The bond formed between the sugar of one nucleotide and the phosphate of an adjacent nucleotide is a covalent bond. A covalent bond is the sharing of electrons between atoms. A covalent bond is stronger than a hydrogen bond (hydrogen bonds hold pairs of nucleotides together on opposite strands in DNA).
erastovalidia [21]3 years ago
4 0
It's known as a phospho-diester bond
You might be interested in
Please helpme on time limit and explain
weqwewe [10]

Answer:

Net force is 100 N

Explanation:

You will use the formula to find the net force/force.

mass = 0.05 kg

acceleration = 2000 m/s^2

F = m × a

F = 0.05 kg × 2000 m/s^2

F = 100 N (Newtons)

Hope this helps, thank you !!

4 0
3 years ago
Differences between plant and animal cells​
Reika [66]
A plant cell has a cell wall and an animal cell doesn’t. The cell wall keeps it from moving and protects the plant.
8 0
4 years ago
If cobalt moved down a period what would it be?
yKpoI14uk [10]
Recall that a period is horizontal, and a group is vertical. 

So if cobalt is moving "down" a period, it would be most logical to say that it would be Ni, or nickel. It could also be Copper, Zinc, Gallium, and so on. Make sense?
5 0
3 years ago
What would happen to a woman astronaut who removed her helmet in space/on mars?
kramer

Not just a woman, but any astronaut:

The air in the suit would rush out, lungs will collapse and you will pass out in 15 seconds (That's how long it takes the body to use up the oxygen). Death by oxygen deprivation

6 0
3 years ago
What proteins use ATP and what types do no use ATP?​
ale4655 [162]

Answer:

not all proteins use atp

5 0
3 years ago
Other questions:
  • What are the differences between the endocrine and urinary system?
    9·1 answer
  • One student did an experiment to find out if fertilizer can make plants grow taller. The steps of the experiment are listed belo
    11·2 answers
  • Which of the following is an example of potential rather than kinetic energy?light flashes emitted by a fireflya molecule of glu
    7·1 answer
  • How does a catalyst influence a chemical reaction?
    13·2 answers
  • What must be true about two objects if heat is flowing between them​
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • What are Krebs cycle inputs and outputs?
    5·1 answer
  • Please help im rlly stuck
    7·2 answers
  • Give away fast fast fast please helping beginners​
    5·2 answers
  • A missense mutation results in which of the following?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!