1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pav-90 [236]
3 years ago
7

Which statement correctly describe one similarity between cellular respiration and photosynthesis?

Biology
1 answer:
Vitek1552 [10]3 years ago
7 0
B. Plz follow and brainliest
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Genes are? A the building that make up proteins
Y_Kistochka [10]

ANSWER:

basically a gene is made up of a DNA. lets say a gene is a functional and physical system that creates habits in you or choices you make. might be difficult to understand but a gene gives you a lifestyle.

~batmans wife dun dun dun...aka ~serenitybella

6 0
3 years ago
Which animal adaptation would be best for this habitat?
Kruka [31]

Answer:

B an animal that can live in fresh water

6 0
3 years ago
Read 2 more answers
If you coil up and coil up and coil up DNA (along with protien) you get a ___________________.??
zheka24 [161]
I believe the answer is chromosomes.
Chromosomes are basically coiled up pieces of DNA with proteins.

I hope this helps! If it doesn't, please reply.
3 0
3 years ago
By which process is water lost
Liula [17]
Execration in man
transport and gutation in plant
8 0
3 years ago
Other questions:
  • What does DNA provide the code for?
    8·2 answers
  • A type of evolution with small scale changes in genes is called what?
    15·1 answer
  • Threshold can be defined as the minimum voltage needed to generate an action potential. Is the threshold for the first action po
    10·1 answer
  • Whistling is considered bad luck among mariners because it challenges the wind. Where did this idea most likely come from?
    15·1 answer
  • . Why was the “flu virus shot” considered an informant?
    14·1 answer
  • Animals have four basic types of _________: nervous, epithelial, muscle, and connective.
    12·1 answer
  • CuSO4 is an example of a(n) _____.
    13·1 answer
  • Please help i need to finish this today before bed and i need a passing grade to start my next assignment.
    14·1 answer
  • According to the theory of evolution what causes living things on earth to change over time
    7·1 answer
  • What is the molecule in this image?<br><br> A. A carbohydrate<br> B. A lipid<br> C. A protein
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!