<span>The nurse will most likely observe Paget's disease on the client's medical chart. Paget's disease interferes with the body's bone tissue recycling process and results in increased blood flow around affected bones, flushing extra alkaline phosphatase and urinary hydroxyproline from the body.</span>
Answer:
"B"
Explanation:
It will have both traits from both parents.
D) DNA is found in chromosomes in the nucleus, while RNA can move around the cell.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Meiosis in reproductive organs (testes and ovary) produce gametes. Each human cell including reproductive cells contains 23 pair of chromosomes. Meiosis separates the two chromosomes from each pair thus, each gamete receives only one copy of each chromosome. Therefore, each gamete has 23 new chromosomes, one from each of the 23 pairs. During meiosis, exchange of chromosome segment between copies of a pair of chromosomes. The exchange of chromosome segments creates new combinations of genes which enhances genetic variability within a species.
