1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djverab [1.8K]
3 years ago
5

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it.

Biology
2 answers:
nasty-shy [4]3 years ago
3 0

Answer:

The catalyst would be the tablets.

Explanation:

The tablets start the reaction. That is what catalysts do.

Arturiano [62]3 years ago
3 0
I think it’s gonna be B.
You might be interested in
In a diploid species of plant, the genes for plant height and fruit shape are syntenic and separated by 18 m.u. Allele D produce
FinnZ [79.3K]

Answer:

C)Parental: 41% Dr, 41% dR; recombinant: 9% DR, 9% dr.

Explanation:

The notation Dr/dR for genotypes means that one homologous chromosome has the alleles Dr and the other homologous chromosome has the alleles dR.

The heterozygous plant  Dr/dR will produce 4 types of gametes: two identical to the chromosmes the individual has in its somatic cells (called parental), and two gametes which will be a mix of the alleles in the homologous chromosomes (called recombinant).

  • Dr: parental
  • dR: parental
  • DR: recombinant
  • dr: recombinant

To calculate the frequency of each type of gamete, we must use the formula:

Distance (map units) / 100 = frequency of recombination.

18 mu / 100 = 0.18.

The total frequency of recombination between the genes D and R is 0.18, but every time crossing over happens, two recombinant gametes are generated. Therefore, each recombinant gamete will have a frequency of 0.18/2=0.09 = 9%.

The frequency of parental gametes will be:

1 - frequency of recombinant gametes

1 - 0.18 = 0.82

But there are 2 parental gametes, so each of them will have a frequency of 0.82/2=0.41 = 41%.

6 0
3 years ago
According to the video shown in class what happens when carbon Bonds are broken.
Masja [62]
C. Energy is released
3 0
3 years ago
Read 2 more answers
Which atom is being researched as a possible ingredient of magnetic soap that can help clean up oil spills? carbon gold oxygen i
yaroslaw [1]

The correct answer is iron.  

The scientists from Britain discovered a soap with magnetic characteristics that could exhibit huge applications in the manner to fight against the damaging oil spills. In the mentioned soaps, the iron-abundant salts are supplemented to establish metallic centers inside the particles of the soap.  

After the solution is treated in a water source, a magnet was utilized to subjugate both the surface tension and gravity of the water, levitating the iron-rich scrubbing bubbles so that they can be withdrawn easily.  


7 0
3 years ago
Read 2 more answers
Decide if the following statements best describe map-based genome sequencing, best describe whole-genome shotgun sequencing, or
iren [92.7K]

Answer:

1. Map-based genome sequencing: a; c; f; g

2. Whole-genome shotgun sequencing: b

3. Both sequencing methods: d; e

Explanation:

Map-based genome sequencing is a method that makes use of a reference genome sequence in order to determine the relative position of the DNA fragments before they are sequenced. This method is useful to determine the position of repetitive DNA fragments (for example, duplicated genes, repetitive non-coding regions, etc.) and Transposable Elements. Therefore, map-based genome sequencing is a suitable approach for large genomes (which are usually composed of repetitive sequences). On the other hand, in whole-genome shotgun sequencing, DNA sequences are obtained before the correct order of these DNA fragments is known. In this method, the genome is fragmented randomly into small DNA sequences (between 100 and 1000 base pairs), which are subsequently sequenced through the chain-termination sequencing approach (i.e., Sanger sequencing) and finally ordered by using bioinformatic tools that assemble overlapping reads.

8 0
3 years ago
10 facts about bacteria
MrRa [10]

Answer:

1  At about 5 million trillion trillion strong, bacteria and their cousins, the archaea, vastly outnumber all other life-forms on earth.

2  Lined up end to end, they would stretch some 10 billion light-years—literally from here to the edge of the visible universe.

3  And there are always more on the way. Pseudomonas natriegens, an ocean-dwelling bacterium, can go from birth to reproduction in 10 minutes flat [pdf]. In five hours a single cell could theoretically give rise to more than 1 billion offspring.

4  Bacteria have been around for at least 3.5 billion years, making them the oldest known life-form on the planet.

5  Humans didn’t catch a glimpse of them, though, until 1674, when Dutch scientist Antonie van Leeuwenhoek spotted tiny swimming “animacules” while fiddling with the newly invented microscope.

6  A compelling argument for brushing: He discovered them while examining pond water and scrapings from the human mouth.

7  Most bacteria have yet to be identified. In 2003 geneticist J. Craig Venter began trolling the high seas and analyzing the water. On his first trip he fished out more than a million never-before-seen bacterial genes.

8  The first artificial life-form will be not a robot but a bacterium. Not content with finding natural bacteria, Venter is leading an effort to build a bacterium from scratch.

9  No escaping them: Your body has 10 times more bacterial cells than human cells.

10  Can’t catch them, either. Whipping their tails, E. coli can travel 25 times their own length in 1 second, equivalent to a horse running 135 miles per hour.

8 0
3 years ago
Other questions:
  • What system does the kidney disease affect
    12·2 answers
  • DNA____.
    12·1 answer
  • Why can only traits controlled by genes be acted upon by natural selection?
    10·1 answer
  • What genotypic ratio is expected in the offspring of this cross
    15·1 answer
  • Piaget believed that _________ are schemes reflecting an infant's repetition of interesting or enjoyable actions that focus on t
    14·1 answer
  • For the common ancestor of all the Bilateria, what was the fate of the blastopore?
    14·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Consider classes A, B and C, where A is an abstract superclass, B is a concrete class that inherits from A and C is a concrete c
    8·1 answer
  • Glucose, a monosaccharide, is found in three different polysaccharides: starch, glycogen, chitin. There are differences between
    8·2 answers
  • PLEASE HELP!!!!!! Answer both of them please!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!