1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MaRussiya [10]
3 years ago
9

The phosphate groups give DNA an overall negative charge that attracts to the positive pole in an electrophoresis chamber. TRUE

FALSE
Biology
1 answer:
topjm [15]3 years ago
3 0

Answer:

The statement is true

Explanation:

The phosphate group in the sugar-phosphate backbone contains a negative charge on the oxygen atom which gives the DNA its overall negative charge. This negative charge on DNA in helpful in the coiling or packaging of DNA around the positively charges histone protein.

This negative charge property of DNA is used in electrophoresis to separate the DNA according to their charge and size. In electrophoresis, the negatively charged DNA is attracted towards positive poles and is separated according to their charge and size. Therefore the statement is true.

You might be interested in
What biome does a hippo live in
kobusy [5.1K]
Well, it depends on the type of hippo.
A common hippo would live in a grassland or savanna kind of place in Africa.

Pygmy Hippos, though, live in Tropical Rainforests.
7 0
3 years ago
An organisms cells include organelles and a cell wall. In which taxonomic group or groups might the organism be classified.
Hunter-Best [27]

Answer:

Plantae, Fungi, or Protista

Explanation:

3 0
3 years ago
You are performing an in vitro experiment in which you will expose a material you are considering for a medical device to synovi
Paul [167]
<h2>Synovial fluid </h2>

Explanation:

Due to the Vroman effect, albumin will initially attach and eventually be replaced by the IgM, which has a higher affinity for the material

The higher concentration of the albumin results in a greater initial surface concentration via diffusion, but it will eventually be displaced by the proteins with greater surface affinity (first the transferrin, and finally the IgM)

If more addition of albumin occurs, which has less affinity for the material surface, will have minimal effect if IgM is already adsorbed to material surface

8 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
What is La Niña and what happens during La Niña?
rosijanka [135]
La Niña is a coupled ocean-atmosphere phenomenon that is the counterpart of El Niño as part of the broader El Niño–Southern Oscillation climate pattern. The name La Niña originates from Spanish, meaning "the little girl", analogous to El Niño meaning "the little boy".
7 0
3 years ago
Other questions:
  • Help I need it... pt. 2
    13·2 answers
  • __________ is a mood disorder that is caused by the body's reaction to low levels of light present in the winter months
    12·1 answer
  • 1 2 3 4 5 6
    13·2 answers
  • How is an individual palm tree growing in a tropical forest called
    9·1 answer
  • Fermentation and/or anaerobic respiration occurs place in this part of the cell. _____________
    14·2 answers
  • Cell theory states that all living things contain one or more cells. Why do you think the cell theory meets the definition of a
    12·1 answer
  • If your body's hypothalamus is not functioning properly, which of the following will happen?
    8·2 answers
  • what happened when you simulated wave movements in your oil spill model. what affect would this have on resource availability fo
    12·1 answer
  • A medicine e.g penicillin which is developed from organism e.g bacteria or fungi and used to fight infections caused by either b
    5·2 answers
  • How are the planets protected from the suns magnetic field
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!