1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shtirlitz [24]
3 years ago
10

Alice's newborn baby girl weighs 3 pounds 8 ounces. What term best describes the baby's birth weight?

Biology
1 answer:
Dvinal [7]3 years ago
7 0

light weight the baby is very small

You might be interested in
Question is in picture
mojhsa [17]

Answer:

  • it can show a population pyramid  
  • They also show the number of dependents (children and, sometimes, elderly people) and general structure of the population at any given moment.
  • it compares and contrast  the age of th female and male where it typically forms the shape of a pyramid when the population is growing which can give you a  general idea on both genders
  • it can help see who (female or male) are the most type in that area

Credit:

  • brainly.com/question/23995769

4 0
2 years ago
The cause of moving currents are in the atmosphere and oceans are connected to ____
Ray Of Light [21]

Answer:

A!

Explanation:

Maybe

6 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Hiiiii I need help with my science again lol. The question is:
TEA [102]
I don’t know the answer but i can recommend two app that might

AP Bio
Cel Biology-101
6 0
3 years ago
Read 2 more answers
Describe the function of each organelle.<br> Endoplasmic reticulum
-Dominant- [34]

Answer:

The functions of the Endoplasmic reticulum are synthesis, folding, modification, and transport of proteins.

3 0
2 years ago
Other questions:
  • Atomic mass is determined by the number of protons plus the number of
    8·1 answer
  • What is used to collect a dna sample from greg answer?
    5·1 answer
  • Autoantibodies are probably involved in:
    13·1 answer
  • Who is generally given institutional responsibility for deciding if an individual researcher is properly trained to perform anim
    14·1 answer
  • Which of the following statements are true? Multiple Choice Muscles work in antagonistic pairs because if one muscle pushes duri
    11·1 answer
  • Which part of cellular respiration uses 2 ATP and produces 4 ATP per glucose molecule?
    10·1 answer
  • _____ is secreted by the _____ and acts to emulsify _____ in the lumen of the _____. _____ is secreted by the _____ and acts to
    10·2 answers
  • Detergents, fertilizers, and raw sewage that make their way into rivers, lakes, and underground aquifers are sources of?
    6·1 answer
  • Why the tropical forest has a more lush plant life than the tundra in regards to how fast things decompose.
    6·1 answer
  • In the process of carbon fixation, three molecules of RuBP combine with three molecules of CO₂ to produce three six-carbon molec
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!