Answer:The Cycad tree is the sporophyte.They have flagellated sperm.
Explanation:
During pollination, the contents of the megaspore divide to form many–celled gamateophyte called the endosperm and archegonium. There is a micropyle opening with a sticky fluid, which traps the wind-borne male gametophyte (microspores) which,at this time is made up of prothallus cell;an antheridial cell and a large tube cell. The trapped microspore is sucked into the archegonia chamber. Antherizoids are released, but only one penetrates each oospore and fuses with the female nucleus. The zygote is formed in the ovule and the later develops into seed.The diploid seed germinates into a new sporophyte plant and the life cycle begins again. Examples of cycad include Cycas circinalis ,Cycas celebrical and Cycas revoluta
Answer:
He
Explanation:
helium has two positive protons and two negative neutrons
and two negative electrons
Genetically engineered seed, or GMO, are foods produced from organisms that have had changes introduced into their DNA using the methods of genetic engineering.
A
Why?:
because i was asking myself what else would make a abyssal plain? and i decided it was a, i WAS gonna say D but i thought really hard about it (plz mark me brain list if it's right is not it's okay and i hope i'm right!) :3
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
