1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kotegsom [21]
4 years ago
8

PLEASE ANSWER ASAP ** which feature is formed where oceanic plates are separating!!?

Biology
1 answer:
grandymaker [24]4 years ago
8 0
Rift valley hope this helps!
You might be interested in
The graphic shows the island of Krakatoa, which disintegrated in 1889, due to the largest volcanic eruption in recorded history.
Nadusha1986 [10]
As you can see in the table presented below, in the first few years after the eruption, there was a significant number of moss species present.
Pioneer species are species that are very resilient and first to inhabit new habitats or repopulate disrupted ones, so in this example, mosses are the most likely candidate for pioneer species.

6 0
4 years ago
How would i give a physical description of the Ebola Virus?
vlabodo [156]
The Ebola virus is a Filovirus that resembles a worm-like shape and has a non-segmented body.
7 0
3 years ago
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
nydimaria [60]

I don see the question if there is one can you explain and ill edit my answer to best fit

8 0
3 years ago
Living organisms share certain characteristics of life. Two living organisms, a pine tree and a sea urchin, are pictured below.
Alinara [238K]
Pine trees are part of the family Pinaceae. Sea urchins are from class <span>Echinoidea. These two organisms are very different in many ways. Pine trees have exposed seeds or sexually reproduce. They are coniferous. Sea urchins, well they don't produced seeds, they reproduce through external fertilization. Sea urchins are omnnivorous. </span>
5 0
3 years ago
Read 2 more answers
What is the relationship between an organism's DNA and its<br> physical characteristics?
statuscvo [17]

Answer: DNA contains the information to make proteins, which carry out all the functions and characteristics of living organisms. DNA carries all of the information for your physical characteristics, which are essentially determined by proteins. So, DNA contains the instructions for making a protein.

4 0
3 years ago
Read 2 more answers
Other questions:
  • List 5 ways that pathogens might be spread in a hospital
    9·1 answer
  • What are two products of alcoholic fermentation by yeast of pyruvate?
    13·1 answer
  • Which of the following lists best summarizes the primate characteristics that laid the foundation for human culture? a. manual d
    10·1 answer
  • A patient reports severe chest pain, back pain, joint pain, hypertension, and redness of the head and neck after receiving a tra
    11·2 answers
  • DNA subunits are called what
    8·1 answer
  • Why is nuclear energy important?
    12·2 answers
  • Identify five different types of fossils
    6·2 answers
  • A client is scheduled for bowel resection with anastomosis involving the large intestine. Because of the surgical site, the nurs
    8·1 answer
  • Tres gases de efecto de kpa quema de combustibles fósiles ​
    12·1 answer
  • Identify the following strand fragments of nucleic acids as RNA or DNA.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!