1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady_Fox [76]
3 years ago
14

Living organisms share certain characteristics of life. Two living organisms, a pine tree and a sea urchin, are pictured below.

Which statement describes a difference in one of the characteristics of life shared by these organisms?
Biology
2 answers:
swat323 years ago
6 0

Answer:

(C) One of the organisms gets energy from the sun, the other does not.

Explanation:

Alinara [238K]3 years ago
5 0
Pine trees are part of the family Pinaceae. Sea urchins are from class <span>Echinoidea. These two organisms are very different in many ways. Pine trees have exposed seeds or sexually reproduce. They are coniferous. Sea urchins, well they don't produced seeds, they reproduce through external fertilization. Sea urchins are omnnivorous. </span>
You might be interested in
A deficiency of what mineral can increase the likelihood of developing a vitamin e deficiency?
harkovskaia [24]

Answer:

Selenium mineral.

Explanation:

Vitamin E deficiency causing by the selenium mineral, not having enough selenium which is needed in our body system, this deficiency can cause many health problems. It is known as a trace mineral which is important for human health.

It may cause premature infants and develop a serious type of anemia, weak muscles and difficulties in walking, impaired coordination, & reflexes. The diagnosis of this deficiency is depends on physical examination, and symptoms.

3 0
4 years ago
An object sitting on a high shelf has no energy. Agree or Disagree
taurus [48]
Agree 
it is no active to use energy to move or be in motion 
6 0
3 years ago
Read 2 more answers
The digestion of pizza, the light reactions in photosynthesis, and the removal of a stain by laundry detergent all require _____
sineoko [7]
The answer is enzymes !!!!!
4 0
3 years ago
Organelles found in plant cells that function through photosynthesis to produce glucose from carbon dioxide and water are called
Brut [27]
Answer: Chloroplasts
5 0
3 years ago
"when would a longer quarantine be needed to prevent the spread of an infectious disease?"
nataly862011 [7]
Rfcdthhggytssdfhhgsss
8 0
3 years ago
Read 2 more answers
Other questions:
  • A genus is composed of a number of similar ...
    9·1 answer
  • Which type of star acts like a “lighthouse” that periodically emits radio waves into space?
    7·1 answer
  • Give two examples of events which would cause genetic drift. Except Fire, Earthquake, Hunting, and Flood. Pleeeeaaaseeee,,
    6·1 answer
  • Each red blood cell carries about 250 million molecules of hemoglobin. How many molecules of oxygen could a single red blood cel
    9·2 answers
  • Can you plz help me :((<br> I will give brainliest
    10·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Ant lions are small insects that dig funnel-shaped depressions in sandy areas. They hide in the dirt at the bottom of the funnel
    14·2 answers
  • Which statement about natural selection is true? (1 point)
    8·1 answer
  • The codon GAG becomes GTG due to a point mutation in the DNA, affecting the structure of the protein hemoglobin. What effect doe
    9·1 answer
  • Scientists are examining the possible role of a large asteroid in the Cretaceous mass extinction event. A large asteroid strike
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!