Answer:
Traits are determined by genes, and also they are determined by the interaction with the environment with genes.
Explanation:
And remember that genes are the messages in our DNA that define individual characteristics. So the trait is the manifestation of the product of a gene that is coded for by the DNA.
Answer:
It is "The opening of flask is pointed in an unsafe direction"
Explanation:
The students were there in the lab to perform practical without obeying the safety rules. The most reasonable basis for teacher's warning here, in this case, is the flask which is pointed in an unsafe direction. It is not specified whether the flask is containing any chemical or not but even if it is empty, it might just fall and break and create injury to anyone present in the lab because, the students are also not wearing proper laboratory wear in accordance to the safety rules which include lab coats, gloves, eyewear, etc. Also, some Students have not tied their hair and more importantly the flasks carrying liquids are not labeled. All of these things might end up in a critical situation for which the teacher warned students about it all.
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
The answer to this would be
The organism is a plant.
Hope this helped! :)
Explanation:
Muscles act on joints antagonistically. Some muscles will contract while other contract pulling on bones around joint hence enabling movement. An example is the elbow joint is moved by antagonistic action of biceps and triceps. When your biceps contract and triceps relax you are able to bend your arm at your elbow. When your triceps contract and biceps relax, your arms straighten.
Learn More:
Learn more about muscle action on joints;
brainly.com/question/10414952
brainly.com/question/13648302
#LearnWithBrainly
