1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yanka [14]
3 years ago
9

Where does interphase and cytokinesis fit in relation to the four stages of mitosis?

Biology
2 answers:
irakobra [83]3 years ago
5 0

Answer:

Interphase: before prophase

Cytokinesis: from anaphase through to telophase

Explanation:

<em>During the interphase, the cell prepares itself for division by actively growing/developing (G1 phase), doubling the amount of DNA (S phase), synthesizing proteins (G2 phase) and other essential molecules required for a cell in division. The cell enters the first stage of mitosis (</em><em>prophase)</em><em> immediately after exiting the G2 phase of the interphase.</em>

<em>Cytokinesis is the division of the cytoplasm. The process of commences at the </em><em>anaphase </em><em>stage of mitosis and continues through to the </em><em>telophase </em><em>stage. The cytoplasm of the mother cell divides physically and two independent daughter cells result.</em>

olchik [2.2K]3 years ago
4 0
Interphase and cytokinesis are preparing the cell to go through mitosis and multiply
You might be interested in
All of the following are conditions that organisms in a tidepool must withstand except
NeX [460]
 d bc (a b c  and d) r the same to make a tidepool
3 0
3 years ago
The cell division process that produces daughter cells with half the chromosome of the parent cell is _________.
STatiana [176]

Answer: Mitosis (A)

Explanation:

5 0
3 years ago
The axial skeleton includes the
Orlov [11]
The axial skeleton inclueds the
answer: A. vertebra, skull, and ribs.
3 0
3 years ago
Water molecule, H2O Oxygen molecule, O2
valentinak56 [21]
The answer would be C. H2O is polar while O2 is nonpolar.
8 0
2 years ago
Read 2 more answers
The Differences Between Monosaccharides &amp;<br> Polysaccharides
saveliy_v [14]

Answer:

simple. the root word mono means one

the root word poly means many.

4 0
3 years ago
Other questions:
  • Select the appropriate statement about healing wounds. A.]Cell growth increases both toward the beginning and the end of the hea
    5·2 answers
  • A large hurricane moves through a small island in the Caribbean. What are the consequences to this island's plant and animal div
    5·2 answers
  • Two pots have been sitting on the stove for a while. One pot has a copper handle and the other has a wooden handle. Which handle
    14·2 answers
  • Some scientists theorize that this behavior developed from the tactic of throwing smaller eggs to break them open. ostrich eggs,
    9·1 answer
  • Which of the following will allow for the greatest reduction in an individual’s carbon footprint?
    8·2 answers
  • What is similar about the primary structure of actin and keratin?
    10·2 answers
  • What DNA sequence produced the following mRNA strand: UGCCGAUAA
    10·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • WHOEVER ANSWERS FIRST GET A BRAINLY!!!!Provide a reason why no 2 communities are ever the same. Support your answer with an exam
    15·1 answer
  • What is the visual acuity of the average human eye?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!