1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuki888 [10]
3 years ago
15

What are the properties and characteristics of metamorphic rock

Biology
2 answers:
lutik1710 [3]3 years ago
5 0

Answer:

metamorphism: Characteristics of Metamorphism In general, a metamorphic rock is coarser and has a higher density and lower porosity than the rock from which it was formed. Under low grade metamorphic conditions, the original rocks may only compact, as in the formation of slate from shale.

Explanation:

user100 [1]3 years ago
3 0
Metamorphic rocks started out as some other type of rock, but have been substantially changed from their original igneous, sedimentary, or earlier metamorphic form. Metamorphic rocks form when rocks are subjected to high heat, high pressure, hot mineral-rich fluids or, more commonly, some combination of these factors. ( This is from google so I recommend you paraphrase this )
You might be interested in
The body is susceptible to
gayaneshka [121]

Answer:

A susceptible person is someone who is not vaccinated or otherwise immune or a person with a weakened immune system who has a way for the germs to enter the body. For an infection to occur, germs must enter a susceptible person’s body and invade tissues, multiply, and cause a reaction.

5 0
3 years ago
Which of the following is NOT a desirable characteristic of an ideal antimicrobial agent?
andrew-mc [135]

Answer: b. It only arrest growth of vegetative cells

Explanation: An antimicrobial agent is a substance that kills o control the growth of microorganisms, for humans this is very important in medicine or agriculture among others.

This agent should act quickly and being stable that help it to make it cheaper, also should not harm humans or other host of the microbial organisms.

The agent is not useful if only kills vegetative cells because it is not preventing the reproduction of the organism specially in fungi which use sexual reproduction as a backup for asexual cell division, so they will keep spreading across the host.  

8 0
3 years ago
Pls help me with this question its science?​
marishachu [46]
Brain
Lunges
Stomach
Liver
6 0
3 years ago
Read 2 more answers
PLEASE HELP I WILL GIVE BRAINLIEST(10 points)
igomit [66]

Answer:

The awnser is c. mucus good luck!

Explanation:

5 0
3 years ago
Oswald Avery helped build our understanding of genetics by showing that:
ivanzaharov [21]
B is the correct answer
3 0
2 years ago
Other questions:
  • As water is heated the motion of the water molecules will generally
    6·2 answers
  • What two events take place during human sexual reproduction
    11·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • 6. Which of the following statements are accurate?
    15·1 answer
  • Witch alignment of the sun, moon , and earth causes a lunar eclipses
    10·1 answer
  • What do you think stupor mean
    12·1 answer
  • Ocean water is sometimes referred to as saline water as it contains significant concentrations of dissolved salts. Please select
    12·2 answers
  • Is this an example of chemical or mechanical weathering? EXPLAIN based on your observations.
    9·1 answer
  • A part of an mRNA has the sequence GGA. Which change to this sequence
    10·2 answers
  • Which of the following is a commensalistic relationship?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!