1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alik [6]
4 years ago
5

PRE-LAB QUESTIONS 1. What is the difference between chemically defined and chemically complex media? Give either a clinical or e

nvironmental research example for which each media type would be the most appropriate choice for culturing microorganisms.
Biology
2 answers:
larisa86 [58]4 years ago
7 0

Answer:

Explanation a chemical define media is a media that do not contain any animal derived source as a component. It is a media whose chemical component are known. It is said to be the purest form of media for culture.

Complex Chemical media is a media whose component are not known. It includes both animals,yeast, plant source whose component are not known this Mixture makes it complex.

Example of complex media is Human Endothelial-SFM (Life Technologies), Endothelial Basal Media, EndoGRO-LS Complete

Example of chemically defined media enhancing or inhibitory effects of GSLs and sphingolipids on tyrosine kinases associated with growth factor receptors.

KengaRu [80]4 years ago
7 0

Answer: The difference between chemically defined and complex media is that the chemical defined contain an exactly known chemical composition while complex media contain an unknown chemical composition.

Explanation: if we grow microorganisms in laboratories, we must provide them with nutrients and conditions they need in order to get a good growth. There are growth media or culture media for this purpose. The culture medium is a solid, semi-solid or liquid substrate that is rich in nutrients and other necessary elements and supports the growth of microorganisms. We carry out isolation, identification, and maintenance of microorganisms on culture media. There are different types of culture media depending on the composition and use. Chemically defined media and complex media are two main types of these. Chemically defined media contain pure biochemical; hence, the chemically defined media contain exactly known chemical composition. However, complex media contain complex materials such as blood, milk, beef extract, etc., so the chemical composition of the complex media is unknown.

Chemically defined media are useful when studying the minimal requirements of microorganisms and for a variety of physiological studies. Furthermore, these media are useful in in vitro cell cultures of human and animal cells. Glucose salt broth is one example of such media. Peptone broth is another example.

Chemically complex media help to grow microorganisms that have complex nutritional requirements.

Furthermore, complex media are usually used for the cultivation of bacterial pathogens and other fastidious bacteria. Nutrient broth/agar, tryptic soy broth/agar, and blood agar are a few examples of complex media.

Good luck

You might be interested in
One example of sound energy around the house is
Bad White [126]

Answer:television

Explanation:I guessed

8 0
3 years ago
Read 2 more answers
Where does the energy come from to break the bonds of the water and carbon dioxide molecules?
Elena L [17]
Energy comes from making bonds in carbon dioxide and water.
3 0
3 years ago
The condition pulmonary fibrosis is caused by the replacement of elastic fibers in the lung with inelastic collagen fibers, whic
JulsSmile [24]

Answer:

Pulmonary fibrosis is a disease that affects the lungs. The lung tissue becomes damaged and scarred which causes it to be thickened and stiff.

The condition pulmonary fibrosis is caused by the replacement of elastic fibers in the lung with inelastic collagen fibers. This decreases the lungs’ ability to stretch outwards.

Pulmonary fibrosis however mainly affects inspiration because the lungs cannot stretch to increase volume while during expiration stretching of the tissues doesn’t happen so it doesn’t affect the process.

4 0
4 years ago
Read 2 more answers
Bacteria, like the Lactobacillus acidophilus use sugar as an energy source for anaerobic cellular respiration. This process prod
Alexandra [31]

Answer: Lactic acid fermentation

Explanation:

The lactic acid fermentation can be defined as the process by which sugar is being converted into lactic acid.

There is no emission of carbon dioxide during the whole process. In case of curd formation. The bacteria convert the milk into curd and provides it a sour taste.

It is converted by help of bacteria known as Lactobacillus acidophillus. This method is very frequently in many of food processing industry.

6 0
3 years ago
Which describes your body's general response to all kinds of injury, from cuts and scrapes to internal damage?
mezya [45]
I think it is inflamation, but not entirly shure
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is a primary function of the active site of an enzyme?
    7·2 answers
  • How does polymerase chain reaction make DNA fingerprinting more reliable
    7·2 answers
  • Imagine that most of the trees are cut down and removed from the nearby
    5·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • If an element has 6 protons, 6 electrons, and 8 neurons, then what’s the atomic number
    6·1 answer
  • Explain how precipitation affects which plants grow in a area?​
    14·1 answer
  • Why does a person need protein in their diet? ​
    9·1 answer
  • A. Efficiency of public services is offered nearby.
    6·1 answer
  • Could you locate a central of expansion
    15·1 answer
  • We used the enzyme, taq polymerase, which is derived from the thermus aquaticus bacterium, in our pcr procedure. Why is this enz
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!