1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
3 years ago
13

Humans are part of complex ecosystems. Describe a few components of the ecosystem in which you live. In your answer: - identify

three abiotic factors and their roles in the ecosystem - identify three biotic factors and their roles in the ecosystem
Biology
1 answer:
DerKrebs [107]3 years ago
8 0
Abiotic factors in common ecosystems:

1: Bats are interesting creatures, and use echolocation to make food
2: The cave walls help spread the voices of the bats
3: They have to use echolocation to breathe

Biotic factors:

1: Some good roles for bats are predators 
2: They effect the system of computers when they bite computer chips
3: They complex human system life<span />
You might be interested in
Aluminum is used to make cans for the beverage industry. In which other industries is aluminum important?
Verdich [7]

Answer:

D.

Explanation:

It's the only choice that has three things that are made out of aluminum.

<em>Hope this helps :)</em>

5 0
3 years ago
What phase of the cell cycle does DNA synthesis occur?
VashaNatasha [74]

Answer:

Interphase

Explanation:

is the only phase that goes through DNA also we are learning the same thing lol

8 0
3 years ago
Susan sat out in the sun watching a baseball game. She developed small blisters on her unprotected shoulders and neck. What type
Simora [160]

Second-degree burn is the type of burn represented by the formation of the blisters.

Second-degree burn is a burn that affects the epidermis and the superficial part of the dermis layer (skin). Second-degree burn may be caused by sunburn, chemicals, scald injuries, flames or electricity. The burn site may appear blistered, red, wet and shiny, and may be swollen and painful.


8 0
4 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
which ecoregion of Texas is most likely to be affected by wind erosion ?f. East Texas Piney Woods G. rolling plains H. Blackland
sweet [91]
F. east texas piney woods
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which does the electron transport chain do during cellular respiration? a - use carbon dioxide to produce glucose b- breaks down
    9·2 answers
  • Which structure of a flowering plant produces female reproductive cells, of eggs?
    7·1 answer
  • A garden has 80 pea plants. Of this total, 20 plants have short stems and 60 plants have tall stems. What percentage of the plan
    13·2 answers
  • What is meant by the EA of a reaction? How do enzymes affect the EA and the DG of a reaction?
    10·1 answer
  • Name the form of polymers derived from petroleum
    7·1 answer
  • What level is the bear part of
    9·1 answer
  • You are a pharmaceutical researcher trying to design a new drug for the treatment of cystic fibrosis. You are aware that an extr
    7·1 answer
  • Name a contractile protein in our body.
    12·1 answer
  • Which belongs in each place
    10·1 answer
  • The structure of dna and the possible base pairs it contains
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!