Answer:
D.
Explanation:
It's the only choice that has three things that are made out of aluminum.
<em>Hope this helps :)</em>
Answer:
Interphase
Explanation:
is the only phase that goes through DNA also we are learning the same thing lol
Second-degree burn is the type of burn represented by the formation of the blisters.
Second-degree burn is a burn that affects the epidermis and the superficial part of the dermis layer (skin). Second-degree burn may be caused by sunburn, chemicals, scald injuries, flames or electricity. The burn site may appear blistered, red, wet and shiny, and may be swollen and painful.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
