1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fantom [35]
4 years ago
8

How many animal cells would fit inside a plant cell

Biology
1 answer:
liberstina [14]4 years ago
3 0
Plant cells can be 3 to 10 times larger than animal cells.  An estimate would be between 3 and 10 animal cells squeezing inside  a plant cell. 
You might be interested in
Which phrase best describes a gene
Valentin [98]
Which phrase best describes a gene?
(1) a segment of a DNA molecule found only in
the body cells of an organism
(2) a segment of a DNA molecule found only in
the gametes of an organism
(3) a segment of a DNA molecule that contains
the instructions for producing a trait in an
organism
(4) a segment of a DNA molecule that contains
the instructions for producing all the
characteristics of an organism
6 0
3 years ago
The two main components of the integument are the:
Natalka [10]
The epidermis and the dermis
7 0
4 years ago
Which statement is an example of causation?
MaRussiya [10]

Answer: The answer is C

Explanation: Causation is the cause of something happening and C is a perfect example. If the news did not spread, the rescuers would have not came to help.

7 0
3 years ago
Let's say that Sam and Joe are identical twins. This means they are like clones of each other. They have the same DNA sequences
galben [10]

Answer: No, only identical twins will look identical.

Explanation:

Identical twins are also called monozygotic twins. Such twins are produced by the fertilization of one egg that splits into two. The genes present in these twins are same thus the expression of traits is also same in them and they have the same sex.

Sam and Joe and Maria and Ella are identical twins these pairs are expected to have same genotypic and phenotypic traits. They may be clones of each other. But if Sam and Maria are married and Joe and Ella are also married then their children will have some similar traits in common but their children will not be identical as they are not identical twins as their parents were.

5 0
4 years ago
What large flat muscle moves up and down in order to bring air in and out of the lungs?
Brrunno [24]
The diaphragm is the large flat muscle. hope that helps :)
5 0
4 years ago
Read 2 more answers
Other questions:
  • What best describes the change in salinity in an estuary at low tide (as water leaves the area)?
    11·1 answer
  • What do photosynthesis and cellular respiration have to do with the law of conversation of mass and chemical reactions?
    12·1 answer
  • What is a molten rock called
    12·2 answers
  • oxygen is needed to produce energy in eukaryotic cells. which organelle would you think needs oxygen the most?
    10·2 answers
  • According to the graph below, at which point is the plant preforming the least photosynthesis?
    8·2 answers
  • What are the three elements found in all sugars?
    5·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Which two products are bromelain likely to produce when breaking down proteins
    11·1 answer
  • If air pollution increases enough to begin reducing the amount of solar radiation to
    5·1 answer
  • Three complex carbohydrates that are very important in living things are starch, cellulose, and glycogen (see below).. All three
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!