1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Delicious77 [7]
3 years ago
6

Why does salt thrown on a frog's body kill it?

Biology
1 answer:
Cloud [144]3 years ago
5 0
The salt drys up the moister on the frog
You might be interested in
Oxygen rich blood returns from the lungs to the heart. Which 2 systems are most directly involved in this process.
Nina [5.8K]

Answer:

Respiratory and circulatory

Explanation:

The Circulatory System Works in Tandem with the Respiratory System. The circulatory and respiratory systems work together to sustain the body with oxygen and to remove carbon dioxide. Pulmonary circulation facilitates the process of external respiration: Deoxygenated blood flows into the lungs.

7 0
3 years ago
Statements about homologous autosomal chromosomes is true
blondinia [14]
It depends on the statement, but most aren't true from my perspective. Perspective also determines the validity of the statement.
Hope this helps and please give brainliest!
7 0
4 years ago
Photosynthesis process ​
Andrews [41]

Answer:

(Down Below)

Explanation:

Some plants and bacteria and protistans use the energy from sunlight to produce glucose from carbon dioxide and water. Oxygen is formed too.

5 0
3 years ago
Small units of carbon can be put together in repeated combinations to form _____. ions energy polymers water
Doss [256]
Ions would require a gas to remove electrons
Energy is when bonds are broken
Carbon doesn't comprise of water
Polymers are comprised of Carbon and Hydrogen, among other things, so that would he the correct answer
7 0
4 years ago
Would a PDA be considered a heart defect?
Sindrei [870]

Answer:YES

Explanation:A PDA is a type of congenital heart defect. A congenital heart defect is any type of heart problem that's present at birth. If your baby has a PDA but an otherwise normal heart, the PDA may shrink and go away. Some children need treatment to close their PDAs.

7 0
3 years ago
Other questions:
  • Which body of water is home to the ENSO cycle?
    11·2 answers
  • Appraise the importance of the role that plants play in the water cycle
    11·2 answers
  • This is a DNA model. What conclusion can you draw from this model? A) DNA has a double helix shape. B) In DNA, complementary bas
    7·1 answer
  • Organisms that eat both producers and consumers are called ____ than stars.
    12·1 answer
  • Which of the following are characteristics of primates? Check all of the boxes that apply.
    13·2 answers
  • Gregor Mendel was an Austrian monk who lived in the 1800s. Mendel is known as the "father of modern genetics" as a result of dis
    10·1 answer
  • living organisms use osmoregulation to balance solute and water concentrations in their cells, tissues and organs. Many marine o
    12·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • How can you define diffusion?
    7·2 answers
  • What is something that both adds and removes carbon from the atmosphere?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!