The worlds most widely grown food crop is

Biology

1 answer:

tresset_1 [31]3 years ago

4 0

<span>The worlds most widely grown food crop is </span>wheat

You might be interested in

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago

Which model shows a prokaryotic cell? a. I b. II c. III d. IV

Cloud [144]

You didn’t show the models but Prokaryotes are unicellular organisms that lack organelles or other internal membrane-bound structures. Here is a picture. I hope it helps

6 0

3 years ago

List the sequence of events involved in the alternation of generations in land plants

Keith_Richards [23]

<span>The sequence of alternation of generation is; gametes->zygote->sporophyte->spores->gametophyte->gametes. The attached diagram shows clearly this looped cycle. Alternation of generation occurs in a more advanced land plant that has distinct haploid and diploid phases in their life cycle. The diploid phase usually involves the sporophyte while the haploid phase involves the gametophyte</span>

7 0

2 years ago

What is the relationship between emerging scientific ideas and open-mindedness?

il63 [147K]

Open-mindedness is needed for the emerging scientific ideas to be accepted (or : to not be rejected without consideration).

Additionally, open-mindedness as a attitude often leads to new scientific ideas emerging: it means that people are more comfortable to try out new things and to test new hypotheses.

6 0

2 years ago

How does selection affect the genetic variation in the population?

fenix001 [56]

Genetic traits that survive through selection increase throughout a population.

6 0

3 years ago