1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lemur [1.5K]
3 years ago
11

Fewer living organisms are found at a desert, deep ocean or high mountain?

Biology
1 answer:
zheka24 [161]3 years ago
4 0

Answer:

High mountains

Explanation:

Because they are high up in the air

You might be interested in
Why did the theory of light change overtime?
bulgar [2K]

Answer:

it is two answers (A and d)

Explanation:

If we keep the same theory of light today we wouldn't be advanced as we are now so yes the old theory had to get updated or plain or replaced with a newer one, D is also correct because if you repeat something you will find out new things from the first time you tried it out.

8 0
3 years ago
Read 2 more answers
What does DNA replication mean?​<br><br>thankyou ~
Anestetic [448]
DNA replication is the process by which a double-stranded DNA molecule is copied to produce two identical DNA molecules. ... An enzyme called DNA polymerase next begins replicating the DNA by matching bases to the original strand.

(Mark as brainliest if you can please if not that is okay )
3 0
2 years ago
Read 2 more answers
What do xylem vessels carry?
nikklg [1K]

Answer:

xylem vessels carry water and minerals and some

ions also

3 0
3 years ago
Read 2 more answers
Analyze the impact nonnative species in terms of population dynamics ??
irina [24]

Answer:

Limiting factors control the numbers of individuals in a population, sometimes maintain it at or near the carrying capacity. 4. Analyze the impact a nonnative species might have on a native species in terms of population dynamics. Nonnative species might out-compete the native species or might prey upon them.

Explanation:

4 0
3 years ago
The Endoplasmic Reticulum ( ER ) was represented by string cheese in the Cell Pizza Lab video . What is the function of the smal
aalyn [17]
I think it’s B

The smooth endoplasmic reticulum serves as a transitional area for transport vesicles. It also functions in carbohydrate and lipid synthesis.
5 0
3 years ago
Other questions:
  • A group of organisms of the same species that live in an area is called a(n) _____
    13·1 answer
  • What is the first thing you should do if an accident occurs in your classroom?
    6·1 answer
  • The building blocks of proteins are <br> 1. amino acids<br> 2. nucleotides<br> 3. base pairs
    10·2 answers
  • What is the Differences between Onion epidermal cells and Mammalian White blood cells?​
    12·1 answer
  • Which organization negotiates trade agreements, settles disputes, and enforces compliance among member nations? A. European Unio
    5·1 answer
  • Why is conserving resources important?
    5·1 answer
  • Black truffles are a unique type of fungi that are highly prized by chefs and food enthusiasts throughout the world. Which chara
    6·2 answers
  • What are the anatomical and embryological conditions for human reproduction?
    12·1 answer
  • Me walking into school when i know im dress code
    11·2 answers
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!