1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
3 years ago
6

A fire in the Everglades damages a large area. A forest fire in Alaska of the same size experiences similar damages. Which ecosy

stem do you predict will recover more quickly? Justify your answer in two or more complete sentences.
Biology
2 answers:
Natasha_Volkova [10]3 years ago
4 0

Answer:

Everglades ecosystem will recover more quickly

Explanation:

Everglades has warmer climate than Alaska. Climate in Alaska is usually very cold and the low temperature limits the biodiversity. When biodiversity is more, species variation is more which means that in case of any natural disaster every species will respond differently and chances of recovery will be more because to begin with there are many species. If not all, at least some will survive and repopulate the area. Lower the biodiversity and species variation, slower will be the recovery from any kind of natural disaster. Hence Everglades ecosystem will recover more quickly from forest fire.

Alla [95]3 years ago
3 0

Answer:

the everglades because of the biodiversity

Explanation:

You might be interested in
Which of the following statements is true?
Ulleksa [173]

Answer:

A. Chromosomes make up genes

Explanation:

8 0
3 years ago
A man with type A blood whose mother was type O is married to a woman with type AB blood. What are the blood types of their chil
zhenek [66]

Answer:

possible blood type

A. 50%

B. 12.5%

AB. 37.5%

:)

6 0
3 years ago
What Best describes the advantage of using the model of a food web?
KatRina [158]
The anwser would be 1
5 0
3 years ago
Read 2 more answers
You are doing an experiment involving antibiotic resistance in your study bacteria. This organism grows well on LB - Miller agar
KiRa [710]

Answer:

See the answer below

Explanation:

The stock solution of Gentamycin has a concentration of 5 mg/ml while each plate needs to contain 50 micrograms/ml of Gentamycin.

5 mg/ml = 5000 micrograms/ml

There is a need to dilute the stock antibiotic solution in order to arrive at 50 micrograms/ml. Using the dilution principle;

m1v1 = m2v2

5000 x 1 = 50 x v2

v2 = 5000/50 = 1000 ml

<em>Hence, in order to prepare 50 micrograms/ml, 1 ml of the stock Gentamycin should be taken and diluted with 999 ml of distilled sterilized water. 1 ml of the diluted Gentamycin will then be added to each agar plate while they are still in the molten form at a warm temperature.</em>

8 0
3 years ago
Speculate as to how the information obtained from the sequencing of the human genome might be used to someday eliminate inborn e
Katena32 [7]

Answer:

Explanation:

Sequencing the human genome is the function of the human genome project with the goal of determining the base pairs/order of DNA nucleotides that make up human genome, and also identifying and mapping all of the genes of the human genome both from the physical level and its functions in molecular medicine. The benefits in this field could allow for better diagnosis of disease, early detection of certain diseases, and gene therapy and control systems for drugs.

Inborn errors of metabolism are rare genetic (inherited) disorders where the body cannot properly digest and turn food into energy through the normal pathway. The disorders are usually caused by mutations in specific enzymes that help in the break down of these foods.

Through the study of the human genome, sequences involved in these mutations giving rise to these disorders are identified and mapped to their variuos locations. This can help in the early diagnosis of the disorders and effective control system for drugs and gene therapy against these disorders.  

5 0
3 years ago
Other questions:
  • A numerical description of the outcome of an experiment is called a
    13·1 answer
  • Which processes lead to most genetic variation in sexually reproducing organisms? select all that apply. select all that apply.
    7·2 answers
  • Suppose the human gene coding for hemoglobin is inserted into a bacterial plasmid. A bacterial culture is transformed with the r
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which structure in the leaf controls the opening and closing of the stoma?
    10·1 answer
  • why was is important to take the test subject's heart rate and blood pressure while sitting quietly with eyes closed
    7·1 answer
  • Different finch species have beaks of different shapes and sizes. What do these beak differences tell us?
    15·1 answer
  • Describe the role of enzymes in seeds germination​
    8·1 answer
  • Which of the following is an example of a producer? a. Oak Tree b. Big Horn Sheep c. California Kingsnake d. Box Jellyfish Pleas
    6·1 answer
  • Ok this is the last one
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!