1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ray Of Light [21]
3 years ago
5

In peas, plants that are true-breeding for a particular trait must be _____ for that trait.

Biology
1 answer:
vodka [1.7K]3 years ago
6 0
They must be homozygous for that trait
You might be interested in
Since the early 1960s, fluoride has been added to many sources of drinking water to prevent cavities in teeth. This is called fl
mestny [16]

The correct answer is:

There is no ASSOCIATION between fluoride exposure and increased cancer risk in humans.

Answer choice A.

7 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Select the correct answer.
katen-ka-za [31]

Answer:

7 pea plant traits that mendel had to study

7 0
3 years ago
Read 2 more answers
A eukaryotic gene contains 14 exons. Most of the transcripts from this gene contain all 14 exons, but some contain only 11 exons
WARRIOR [948]

Answer:

D. Alternative splicing is the mechanism that produce complexity in the genes by splicing some of the protein coding part (exons) of a genes

Explanation:

There are certain splicing enhancers sites present in Exons which facilitiates the binding of RNA binding protein specifically SR protein family rich in Serine and Arginine residues. This SR protein will help in splicing of exons.

The significance of this type of mechanism is the ability of a cell to produce an isoform of protein which have retain their function.

This mechanism also help is diversity or in short in evolution.

8 0
2 years ago
Protozoans are the only organisms that can convert nitrogen from the air into chemical compounds that plants can use.
tigry1 [53]

Answer: False

Explanation:

Protozoans are not the organism that fix nitrogen for the plants. The organism that fix nitrogen to convert it into a form which can be used by plants are known as diazotrophs.

These are bacteria and archae that fix nitrogen gas found in the atmosphere into more usable form such as ammonia.

These organism can grow without any external source of fixed nitrogen. Example: Rhizobia and azospirillium.

5 0
2 years ago
Other questions:
  • The mitral valve separates which two chambers of the human heart?
    6·1 answer
  • The sequence of depositional units at a site is referred to as the siteʹs __________.
    13·1 answer
  • PLLLLLEEAASSSEE HELLOPPPPPP!!
    9·2 answers
  • What is the function of a raphide crystal?
    15·2 answers
  • If your grandparents are coming over for a couple of weeks, and they would like to know what is the weather there, what question
    12·1 answer
  • What is the difference between Recessive and Dominant traits?
    12·1 answer
  • What is organism complexity?
    14·2 answers
  • In a population of weasels, black (R) is the dominant color and white (W) is the other dominant trait. In weasels, fur color fol
    5·2 answers
  • En cuales sitios del cloroplasto se realizan las fases luminosas y oscura​
    6·1 answer
  • Internal forces of sources which what is exert on each other in the bodies are part of the system is 
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!