1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NNADVOKAT [17]
2 years ago
5

Order from longest to shortest

Biology
1 answer:
svetlana [45]2 years ago
4 0
Eón,era,period,epoch
You might be interested in
Help quick!! Will give brainst!!
IceJOKER [234]

Answer:

combustible        ....................

6 0
2 years ago
Read 2 more answers
Which activity is most likely to lead to lactic acid fermentation?
lbvjy [14]
It’s D “doing 100 sit ups in 5 minutes”
4 0
3 years ago
If b is dominant over b, list the offspring that will exhibit or show the dominant trait.
Lelechka [254]

Answer:

if its BB or Bb the offspring will show the dominant trait

Explanation:

If its bb then the trait wont be expressed

5 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
What is the source of energy for thermoacidophiles archaebacteria
nikklg [1K]

There are so many examples for that in different areas, like biology experiment carried out in our lab recently.

Here's one link: https://www.creative-biogene.com/Robust-Tn5-Transposase-EMQZ1422-1271506-26.html


6 0
3 years ago
Other questions:
  • Which of the following conditions favors "big-bang" reproduction?a. high rate of offspring survivalb. intense inraspecific compe
    12·1 answer
  • Identify the components of seawater
    10·1 answer
  • How does the continents move?
    9·1 answer
  • Aldosterone is a hormone released by cells in the adrenal gland in response to an anterior pituitary gland hormone. Antidiuretic
    12·1 answer
  • Bacteria reproduce in a process called binary fission. Which of the following statements is true about binary fission?
    6·2 answers
  • Most of the photosynthesis in plants takes place in the
    7·2 answers
  • What do the arguments for and against the use of stem cells in medical research share?​
    11·2 answers
  • Answer this......<br>please.........<br>..<br><br><br><br>​
    8·2 answers
  • What element is essential for microbes and can restrict the growth of pathogens when bound by antimicrobial proteins
    15·1 answer
  • The brain is in which part of the nervous system?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!