1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elis [28]
3 years ago
6

Allergy to pollen is classified as:

Biology
1 answer:
Stells [14]3 years ago
3 0

The correct answer is D. Immediate hypersensitivity

Explanation:

Allergies are different conditions that occur when an organism is exposed to an allergen, which is a substance, elements, etc that leads to an abnormal immune response. Because of this, allergies are mainly explained as immediate hypersensitivity in the immune system as they usually occurred shortly after the organisms are exposed to the allergen and it is a. Types of allergies include allergies to food, allergic asthma, etc that lead to symptoms such as sneezing, swelling rashes, etc. Therefore, allergy to pollen as any other allergy is classified as an immediate hypersensibility.

You might be interested in
Which energy carriers are produced be the Calvin cycle
babunello [35]
ATP is produced in the Calvin cycle 
6 0
2 years ago
Read 2 more answers
What is an experiment topic
Zigmanuir [339]
Science experiments can be like “measuring how heart rate is effected by music “
5 0
2 years ago
How dose land use change as the human population increases
pashok25 [27]

Answer:

Land use goes up as human population goes up. This is because the more people there are alive, the more land that people will be using. Hope this helps :)

5 0
3 years ago
Read 2 more answers
Water has a high specific heat, a high heat of vaporization and has the ability to slow heat gain and loss because of its
gayaneshka [121]
...strong hydrogen bonds between the oxygen and hydrogen atoms of neighbouring atoms increases the amount of energy needed to cause water to change states. 
7 0
3 years ago
Complete the following statement carbon dioxide water and energy are the reactants for. well beginnings the products for
Strike441 [17]

Photosynthesis. These are the reactants for photosynthesis and the products of cellular respiration.

5 0
3 years ago
Other questions:
  • Which process uses carbon dioxide
    7·2 answers
  • Tissues can best be described as
    13·1 answer
  • To incorporate desired genes, a______ is used.
    9·2 answers
  • Eggs and sperm are examples of _____?
    14·1 answer
  • Plants make food through photosynthesis, a chemical reaction.
    12·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Hey could someone help me with this? i’ll mark u brainiest if u don’t guess or leave links!
    11·1 answer
  • Hi, please help me! I have to submit very soon!
    6·1 answer
  • 4. Which one in the choices is the function of proteins?<br> a. steroids<br> b. collagen
    9·2 answers
  • Helpppppppppppppppppppp
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!