1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivanshal [37]
3 years ago
6

Which of the following is an example of an organic molecule?

Biology
1 answer:
ivolga24 [154]3 years ago
8 0

b because im trying to help hope it helps :)))


You might be interested in
In some animals, brown eyes (B) are dominant over blue eyes (b). Which of these genotypes will complete this Punnett square?
Novay_Z [31]
You answer would Bb
<span>B b
B BB ??
b Bb bb</span>
7 0
3 years ago
Read 2 more answers
Why is the brain an important component of the nervous system
Tema [17]
Basically, because it controls it. It sends all the signals to everything and tells them what to do. Without the brain, nothing would happen, and you would die.

Hope this helps.<span>
</span>
7 0
3 years ago
Read 2 more answers
Need help with biology homework
nydimaria [60]

Answer:

you just draw what the question asks you to do.

Explanation:

6 0
3 years ago
What if decomposers were not there
Murrr4er [49]
If decomposers were here then their would be a ton of waste and the dead and bacteria will pile up
8 0
3 years ago
Read 2 more answers
Which is one way that carbon returns to the atmosphere during slow-track carbon recycling?
Sveta_85 [38]

Answer:

B

Explanation:

A) plants release oxygen and absorb CO2

6 0
3 years ago
Other questions:
  • What is this?
    13·1 answer
  • Why do scientists believe the polar ice is disappearing?
    7·1 answer
  • Which is not a consumer?<br>A. Zooplankton<br>B. Phytoplankton<br>C. Fish<br>D. Sea turtle​
    11·2 answers
  • Consider a recessive mutation that results in a complete loss of gene function. If heterozygous individuals (mutant/wild-type) a
    12·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Can humans cause an imbalance in the food chain
    6·1 answer
  • If a mutation in the dna of a globular enzyme changed all of the leucine amino acids to isoleucine, predict how the relative pos
    11·1 answer
  • Would remote sensing be a useful way to monitor other ecosystems on Earth? Provide evidence to support your answer.
    9·1 answer
  • Pls help!! I’ll mark brainliest!!!
    13·1 answer
  • Would a cell that did not undergo cytokinesis be able to function properly? Explain.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!