1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
madreJ [45]
3 years ago
10

The _______ is responsible for forming the outer, limiting barrier of a cell.

Biology
1 answer:
Jet001 [13]3 years ago
4 0
The Plasma membrane<span> is responsible for forming the outer, limiting barrier of a cell.</span>
You might be interested in
Which of the following is a natural result of overpopulation?
maria [59]
The answer is
b. The food runs out and visuals in population starve
6 0
3 years ago
Read 2 more answers
NEED HELP WITH THESE TWO QUESTIONS ASAP PLEASEEE!!!!!!!!!!!!!!!!!!!
OlgaM077 [116]

Answer:

idk

Explanation:

idk

4 0
3 years ago
3 main stages of translation
taurus [48]

Translation proceeds in three phases: Initiation: The ribosome assembles around the target mRNA. The first tRNA is attached at the start codon. Elongation: The tRNA transfers an amino acid to the tRNA corresponding to the next codon.

8 0
3 years ago
why is it easier/ faster for our body to digest candy than pasta? candy contains disaccharides and thus contains more substrate
Zanzabum

Pasta contains starch and thus contains more substrate and needs more enzyme to digest.

<h3>What is starch ?</h3>

A polymeric carbohydrate called starch, also known as amylum, is made up of a lot of glucose units connected by glycosidic linkages. The majority of green plants synthesize this polysaccharide as a form of energy storage. It is the most prevalent type of carbohydrate consumed by people worldwide and is present in significant proportions in common foods like wheat, potatoes, maize (corn), rice, and cassava (manioc).

Pure starch is a powder that is white, odorless, tasteless, and insoluble in alcohol or cold water. It is made up of the branching amylopectin and the linear and helical amylose molecules. Starch typically comprises 20 to 25% amylose and 75 to 80% amylopectin by weight, depending on the plant. Animals store their energy in glycogen, which is a more intricately branched form of amylopectin.

To learn more about starch from the given link:

brainly.com/question/1237142

#SPJ4

7 0
1 year ago
1. Explain how living things<br> follow the law of<br> conservation of energy
Alenkinab [10]
Plants use the sun to produce food then animals eat the plants for food
4 0
3 years ago
Other questions:
  • This waxy coating is which of the following types of organic molecule
    13·1 answer
  • Why is soil important to plants? a. It provides them with nutrients. b. It provides them with water. c. It provides them with a
    9·2 answers
  • The energy role of a grizzly bear is that of a(n) ________ because it cannot make it's own food
    15·1 answer
  • Which of the following properties of life is likely NOT to be a common
    9·2 answers
  • What’s number 11 on a grid system on a globe: terms review
    12·1 answer
  • Sexual reproduces offspring that are genetically ___ to the parent.
    12·1 answer
  • Protozoa are a type of unicellular organisms.<br><br> True<br> False
    12·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which of the following facts supports the argument that a pregnant cow should be fed more in its last trimester?
    9·1 answer
  • What makes an item scarce?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!