1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makvit [3.9K]
3 years ago
11

One of the nurses describes a disorder by telling the group that it is common in children during the summer when it is hot or wh

en the child is overdressed. which disorder is the nurse most likely referring to?
Biology
1 answer:
aleksklad [387]3 years ago
6 0
This nurse is most likely describing a heat stroke.That happens when the child’s body can’t spread or handle the heat because it is trapped under the clothing
You might be interested in
What is a control value?
Inga [223]

Answer:

The value of control is a quantitative measure of the value of controlling the outcome of an uncertain variable. Decision analysis provides a means for calculating the value of both perfect and imperfect control. The former value, informally known as the value of wizardry, is an upper bound for the latter. Obtaining meaningful value-of-control measurements requires an awareness of important restrictions (concerning the nature of free will and the meaning of counterfactual statements) on the validity of this kind of analysis.

5 0
3 years ago
Read 2 more answers
0. How might the channelization of rivers affect populations in river ecosystems?
worty [1.4K]

Answer:

D.

Explanation:

Hope this helped!

5 0
3 years ago
Read 2 more answers
Cuanto es 1+1 ?<br><br>ayúdame para responder :( <br><br>​
malfutka [58]

la respuesta es 2!!

:)

6 0
2 years ago
Read 2 more answers
Using the DNA sequence below, what would the resulting amino acid sequence be? Be sure to show any necessary steps that lead you
IceJOKER [234]

Answer:

Notice that many amino acids are represented in the table by more than one codon. For instance, there are six different ways to "write" leucine in the language of mRNA (see if you can find all six).An important point about the genetic code is that it's universal. That is, with minor exceptions, virtually all species (from bacteria to you!) use the genetic code shown above for protein synthesis.

Explanation:

3 0
2 years ago
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
2 years ago
Other questions:
  • Why does sexual reproduction produce offspring with characteristics that are different from their parents, where as offsprings p
    7·1 answer
  • How many kilometers north of the equator is washington, D.C.
    11·2 answers
  • Is lichen growing on rocks a mechanical or a chemical
    7·2 answers
  • Why doesn't a negative stain colorize the cells in the smear?
    11·1 answer
  • How has human activity impacted the evolution of the peppered moth?
    14·1 answer
  • PLZ HELP ME!
    13·2 answers
  • Which term describes resistance to change in motion? A. Acceleration B. Inertia C. Net force D. Velocity
    12·1 answer
  • 1. Signal Transduction Pathways start with a _____________________ in the form of a __________________ message that is _________
    9·1 answer
  • on the keys and kingdoms activity worksheet what does How many different genus groups are there ? list them mean?
    9·1 answer
  • Give two examples of elevation
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!