Answer:
The value of control is a quantitative measure of the value of controlling the outcome of an uncertain variable. Decision analysis provides a means for calculating the value of both perfect and imperfect control. The former value, informally known as the value of wizardry, is an upper bound for the latter. Obtaining meaningful value-of-control measurements requires an awareness of important restrictions (concerning the nature of free will and the meaning of counterfactual statements) on the validity of this kind of analysis.
Answer:
Notice that many amino acids are represented in the table by more than one codon. For instance, there are six different ways to "write" leucine in the language of mRNA (see if you can find all six).An important point about the genetic code is that it's universal. That is, with minor exceptions, virtually all species (from bacteria to you!) use the genetic code shown above for protein synthesis.
Explanation:
It should be
AGATACCATGGTTACCCGGTTCCA
