1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elza [17]
3 years ago
7

What is an example of form following function?

Biology
1 answer:
marshall27 [118]3 years ago
8 0
Wainwright Building by Louis Sullivan. Form follows function<span> is a principle associated with modernist architecture and industrial design in the 20th century. The principle is that the shape of a building or object should be primarily based upon its intended</span>function<span> or purpose.</span>
You might be interested in
A population is a population is a group of individuals of the same species that live in the same area and interbreed. all indivi
neonofarm [45]
C. a group<span> of</span>individuals<span> of a </span>species plus all<span> of the </span>other species<span> with which </span>they<span> intera</span>
6 0
3 years ago
Why is carbon the backbone of liveing things
Lyrx [107]
Because of its ability to form large complex and diverse molecules
3 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Choose all the answers that apply.
atroni [7]

Answer:fertillizer

Explanation:

7 0
3 years ago
Read 2 more answers
What will happen to a food chain if the species at the bottom dies out
melisa1 [442]

The food that was going to get getting eating that animal or whatever is going to grow

6 0
4 years ago
Other questions:
  • Which of the following philosophical approaches is modern evolutionary biology based upon?
    12·1 answer
  • PLEASE HELP ME I REALLY NEED THE ANSWER
    15·1 answer
  • The d-value of a bacterial culture heated to 100°c is the time it takes to kill ________% of the population.
    13·1 answer
  • One essential factor for quality infant day care is: encouraging competition among infants. attention to health and safety. two
    9·1 answer
  • Pls help I asked 3 times and I used all my points!! Which field studies all organisms that have existed, where they came from, a
    9·2 answers
  • Explain how MAGIC is possible.
    10·1 answer
  • The chemical factors that determine traits are called
    12·1 answer
  • Bones _____. Make blood cells are controlled by smooth muscles are part of the autonomic nervous system are connected to muscles
    7·1 answer
  • Describe Hydrogen Bonding.<br><br><br> BEST ANSWER GETS BRAINLIEST
    6·1 answer
  • In florida, black bears are found in only a few regions. Roads and highways cross all of these regions. If new road construction
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!