1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tia_tia [17]
3 years ago
11

What is a triple bond

Biology
2 answers:
erik [133]3 years ago
3 0
<span>A triple bond is:

A chemical bond in which three pairs of electrons are shared between two atoms.</span>
pshichka [43]3 years ago
3 0

A covalent bond between 2 atoms where each atom contributes 3 electrons.

You might be interested in
Which of the following can be considered fossils?
marysya [2.9K]
D.......................
3 0
3 years ago
Garbage buried in an engineered and sealed landfill can still contain all of the following except
sleet_krkn [62]

Answer:

C- groundwater

Explanation:

I took the test

8 0
3 years ago
Read 2 more answers
Como una proteasa separa las proteínas, ¿qué se creará una vez que todo esté completamente digerido?
Ganezh [65]
What asdfghjklytrewqkkk
8 0
3 years ago
In which part of the plant would you expect to find cells with the most chloroplasts
Charra [1.4K]
The leaf because it is the major structure of photosynthesis in a plant.
7 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • Compared with deciduous forests, coniferous forests _____. tend to contain more broadleaf evergreen trees are more likely to be
    14·2 answers
  • How does a bullfrog affect the ecosystem on a biotic and abiotic factor in the environment
    12·1 answer
  • 3. Sarah, who has a mass of 55 kg, is riding in a car at 20 m/s. She sees a cat crossing the street and slams on the brakes! Her
    11·2 answers
  • What is one difference between a total solar and total lunar eclipse
    10·1 answer
  • Enter the molecular formula for butane, C4H10. Express your answer as a chemical formula.
    13·1 answer
  • Wetlands are areas where water covers the soil. Swamps, marshes, and other wetland areas help to control flooding because they n
    7·1 answer
  • Visit the link below and use the information to
    10·2 answers
  • What are some personal thoughts on air pollution.
    12·1 answer
  • How are molecules like glucose used by the body?
    11·1 answer
  • PLEASE HELP ME WITH THIS​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!