Humans store excess polysaccharides in the form of glycogen.
Polysaccharides are carbohydrates. They are generally used to generate energy in the form of ATP for the body's metabolic activities.
Carbohydrates are broken down during respiration to generate energy. Excess carbohydrates are generally converted to glycogen through the actions of an enzyme in the liver.
Glycogens are converted back to simpler carbohydrates when there is inadequate carbohydrate in the body.
More on carbohydrate homeostasis can be found here: brainly.com/question/17563062?referrer=searchResults
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
It can be possible because the mother can present B blood phenotype. This opens the possibility of she having an heterozygous genotype of I^b i or I^b I^b which are dominant over the genotype of the O type father.
I believe it results to a conformation change that moves the Na+ binding site to the inside of the cell. ATP hydrolysis involves the release of chemical energy that has been stored in the high-energy phosphoanhydride bonds in adenosine triphosphate.For example in muscles. The process of moving sodium and potassium ions across the cell membrane is an active transport process involving the hydrolysis of ATP to provide the necessary energy. It involves an enzyme referred to as Na+/K+ ATPase.
