1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna007 [38]
3 years ago
13

If all deer the disappeared from this community which change would be most likley to occur

Biology
2 answers:
Anna35 [415]3 years ago
8 0
They mostly feed on vegetation. If there was no deer, grass would grow to enormous lengths, wolfs and other predators would start to die and it would harm the natural way of life, slowing killing everything
kherson [118]3 years ago
6 0

Answer:

Yes

Explanation:

Yes because all animals that feed on deers would eventually have nothing to eat and that species would die out, leaing to other animals going extinct. :)

You might be interested in
HELP PLEASE WILL GIVE BRAINLY! <br><br> What is a complementary RNA strand to AGA?
Irina18 [472]

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

5 0
2 years ago
at which location does gravity play a role in moving tectonic plates? at the edge of the plates. in the core. in the mantle. in
yulyashka [42]

Answer:

B. At the edge of the plates

Explanation:

<u>Gravity </u>is the principal <u>driving force </u>of <u>plate tectonics </u>(second one is convection<u>)</u>. It causes different density plates to move on the Earth's surface. However, when a <u>denser plate coincides the less denser plate, the high density plate subducts</u> below the <u>lesser density plate</u>. The process, therefore, is called <u>subduction</u>. During this collision of plates, <u>shearing resistance increases</u> and all <u>pressures come at the edge of the plate</u>. The process continues and the lithosphere drags the rest of the plate. The portion of plate below the less denser plate then reaches the mantle. Here, the edge of plate is destroyed due to high temperature of mantle as well as pressure.

7 0
3 years ago
Which cells of bones secrete the matrix of Hanoverian canal?
Ipatiy [6.2K]
Osteocytes is a bone cell formed when an osteoblast becomes embedded in the matrix it has secreted. So it would be that osteocytes secrete the matrix of Hanoverian canal.
3 0
3 years ago
What does theory mean to a scienist?
Rama09 [41]
A theory is a set of sentences which is closed to make logical implications.
6 0
2 years ago
Read 2 more answers
Which statement does not explain the concept of the Doppler effect ?
sesenic [268]

Answer:

Doppler effect is a change in frequency and wavelength of a wave. It is caused by the change in distance between the thing creating the wave (causer) and whatever is measuring seeing or hearing the wave (watcher or observer). Another word for "causer" is "sender".

HOPE THIS HELPED!!!!!!!!!!!!!! XDDDD

3 0
2 years ago
Read 2 more answers
Other questions:
  • When energy goes up in a food chain how does it impact of higher level consumers?
    11·1 answer
  • the model of DNA used today was proposed by James Watson and Francis Crick in 1953 in this model what sequence of bases would be
    10·1 answer
  • Which of the following is not true about sedimentary rocks?
    6·1 answer
  • Lions live in groups called prides. Lion populations would most likely fall in which category of population distribution? a. eve
    14·2 answers
  • ___________ are chemicals produced by the body, such as the brain, and can change moods and actions and even resemble some recre
    9·1 answer
  • The presence of many C-C and C-H bonds causes fats to be ... The presence of many C-C and C-H bonds causes fats to be ... (a) ri
    10·1 answer
  • When sodium chloride is dissolved in water the sodium ions do what​
    10·1 answer
  • I need help pls someone
    10·2 answers
  • Is Brainly 2$ a month. Why does it say I will be billed 24$
    8·1 answer
  • What gives carbon the ability to form chains that are almost unlimited in length?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!