Answer:
ATGGCCTACGGTCTAGTTTAG
Explanation:
A=T
C=G
G=C
T=A
This is the key to finding a complementary <u>DNA strand</u>.
Tameeka probably has<u> "Pelvic inflammatory disease (PID)".</u>
Pelvic inflammatory disease (PID) alludes to an inflammation influencing any piece of the upper female genital tract, including the uterus , fallopian tues and ovaries. The provocative condition is typically caused by untreated explicitly transmitted diseases (STIs), especially Chlamydia trachomatis and Neisseria gonorrhea. It might likewise be caused by a contamination from other microscopic organisms in the vagina which have entered to the uterus.
Pelvic inflammatory disease (PID) is most usually an inconvenience of explicitly transmitted diseases (STIs) , especially with chlamydia or gonorrhea.
Hypospadias is a condition in males where the opening of the urethra is a the bottom of the penis. This results in the following complications which should be reported immediately:
<span>
When the temperature is greater than 101 °F
Excessive bleeding (some spotting or blood stains on the dressing is normal)
Extreme irritability
Excessive pain
Increasing redness of the penis
Disinterest in eating and drinking (particularly after 24 hours)
Continuous vomiting
Change in urination
Difficulty urinating (pushing when he urinates)</span>
The physiological subset of birds are - 1) spirits 2) fat accumulation 3) gonadal development 4) gonadal degeneration 5) napping 6) fat accumulation.
<span>Osteoclasts is the answer you are questioning for. </span>
