1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dybincka [34]
3 years ago
15

Please help! Directions

Biology
1 answer:
murzikaleks [220]3 years ago
3 0
-biotic are living things like squirrels, ivy
-abiotic are factors in the ecosystem that aren't alive like the sun or air
-populations are the types of animals like frogs or fish
- A niche is the role and position a species has in its environment; how it meets its needs for food and shelter, how it survives, and how it reproduces
-
You might be interested in
A Lamar is a type of mudflow that occurs
Morgarella [4.7K]
A Lamar is a type of mudflow that occurs after a volcanic eruption.
5 0
3 years ago
1.
likoan [24]
C is your correct answer.

- the unique living arrangement of an organism defined by its habitat, food sources, time of day it is most active, and other factors

8 0
3 years ago
Read 2 more answers
Group translocation is a special _______ transport process across the cytoplasmic membranes of _______.
sasho [114]

Answer:

active; prokaryotes

Explanation:

Active transport can be defined as the movement of molecules across cell membranes against a concentration gradient, i.e., from a region of low concentration to a region of high concentration. Group translocation is a specialized type of active transport observed in prokaryotic cells. In group translocation, the transported substance is chemically modified during its movement, thereby the cell membrane becomes impermeable to this substance once it is within the cell. In bacteria, the phosphotransferase system is a type of group translocation that uses phosphoenolpyruvate (PEP) as a source of energy to transport sugar molecules into the cell.

6 0
3 years ago
Which of these states would be the best location for solar panels?
Harrizon [31]
C? because it is one of the best location for solar panels, even says it on the answer choice “receives a large amount of radiation”.
5 0
4 years ago
Read 2 more answers
What type of weather will a warm front bring? *<br> cold<br> cool<br> breezy<br> warm
vodka [1.7K]

Answer:

warm or breezy.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Alicia would like to determine the effect of epinephrine on a fish's heart rate. Alicia designs the following experiment: 1. Sel
    11·1 answer
  • Are these correct??????
    14·1 answer
  • Sexual reproduction is important for the survival of the species for all but one of these reasons
    8·1 answer
  • Which statement is accurate about the number of genes in different species of living things? A. All living things have about the
    12·2 answers
  • ____ first investigated the neural components regulating the brain's sleep-wake mechanisms in 1949
    11·1 answer
  • What structure closes the entrance to the trachea (the glottis) when you are swallowing food and prevents choking?
    11·2 answers
  • Select all of the reasons that a multicellular organism's cells undergo mitosis. question 33 options: to regenerate and repair t
    5·1 answer
  • Which classes are included in the group Tetrapoda?.The choices are: Bony fishes, Amphibia, Reptilia, Aves, and Mammalia. . . . A
    7·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Can anyone know this
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!