Answer:
0.2404
Explanation:
The genes R/r and E/e are linked and there is 4% recombination between them.
<u>The possible genotypes and phenotypes are:</u>
- RR or Rr: Rh+ blood type
- rr: Rh- blood type
- EE or Ee: elliptocytosis
- ee: normal red blood cells
Tom and Terri each have elliptocytosis (they are E_), and each is Rh+ (they are R_).
Tom's mother has elliptocytosis (E_) and is Rh- (rr), so she has the genotype Er/_r. His father is healthy (ee) and has Rh+ (R_), so he has the genotype eR/e_. Tom must have inherited his E allele from his mother and his R allele from his father, so he has the genotype eR/Er.
Terri's father is Rh+ (R_) and has elliptocytosis (E_), while Terri's mother is Rh- (rr) and is healthy (ee) with the genotype er/er. Terry could only receive the chromosome <em>er </em>from her mother, and because she is heterozygous for both genes the dominant alleles were both received from her father. Terri's genotype is ER/er.
The frequency of recombination is 4%, so 4% of the produced gametes will be recombinant. There are two possible recombinant gametes, so each will appear 2% of the times (a frequency of 0.02).
<u />
<u>Tom will produce the following gametes:</u>
- eR, parental (0.48)
- Er, parental (0.48)
- er, recombinant (0.02)
- ER (recombinant (0.02)
<u>Terri will produce the following gametes:</u>
- ER, parental (0.48)
- er, parental (0.48)
- Er, recombinant (0.02)
- eR, recombinant (0.02)
A child Rh- with elliptocytosis has the genotype rrE_. This can happen from the independent combination of the following gametes from Tom and Terri respectively:
- Er (0.48) × er (0.48) = 0.2304 Er/er
- Er (0.48) × Er (0.02) = 0.0096 Er/Er
- er (0.02) × Er (0.02) = 0.0004 er/Er
And the total probability of having a rrE_ child will be 0.2304 + 0.0096 + 0.0004 = 0.2404
Answer:
a. Men and women differ physically in some limited ways.
Explanation:
The concept of physical superiority is a relative one, so to say that one gender is physically superior to another is wrong not only socially, but also biologically. That being said, there are still some physical differences between men and women. For instance, men in average, tend to be taller and stronger than women, while women tend to have a higher pain threshold than men. Therefore, the most appropriate statement is that a. Men and women differ physically in some limited ways.
Answer:
CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA
Explanation:
Cytosine pairs with Guanine.
Adenine pairs with Thymine.
Answer:
Compound microscopes have more than one lens to generate high magnification images of flat, thin specimens. There are three major structural parts of a microscope: Head, Base, and Arm. ... The light is then collected and formed an image by an objective lens. We see the magnified images through the eyepiece
Explanation:
