Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The increased temperature melts glaciers, ice caps etc. and thus increases the sea levels
It is the Glucose. Glucose is a basic sugar with the atomic recipe C6H12O6. Glucose courses in the blood of creatures as glucose. It is made amid photosynthesis from water and carbon dioxide, utilizing vitality from daylight. It is the most imperative wellspring of vitality for cell breath.
