1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilya [14]
3 years ago
15

What is the last stage of mitosis

Biology
2 answers:
Nostrana [21]3 years ago
8 0
Telophase.


Mitosis goes from prophase --> metaphase --> anaphase --> <span>telophase</span>
SpyIntel [72]3 years ago
5 0
The last stage would be telophase
You might be interested in
How could you revise this statement to be more complete or correct?
Luden [163]

Answer:

What is the statement?

Explanation:

6 0
3 years ago
Read 2 more answers
Which of these is not considered a potentially hazardous food?
Leni [432]
Answer choices please
8 0
3 years ago
Which event occurred during the Mesozoic era? A. Humans lived on Earth. B. The first plants lived on the land. C. Pangaea, the s
andreev551 [17]
<span>B. The first plants lived on the land.</span>
4 0
3 years ago
Are ladybugs herbivores carnivores or omnivores
kobusy [5.1K]
Lady bugs are carnivores. If you want to get more technical they are insectivores. This is because they only eat soft bodied insects/arachnids like aphids, mites, and scale insects.
8 0
3 years ago
5.
12345 [234]
Do a cross graph with B and W
7 0
2 years ago
Other questions:
  • Milicent finds a plant in her backyard. It is tall and has large cones. What did Milicent find? answer needed asap
    8·1 answer
  • WORTH 25 POINTS AND BRAINLIEST!!!
    6·2 answers
  • Catastrophism, meaning the regular occurrence of geological or meteorological disturbances (catastrophes), was Cuvierʹs attempt
    9·1 answer
  • Share 3-5 different reasons people may eat food beyond the need for nutrients. For example, you could describe the role of food
    7·1 answer
  • You are a marine biologist. what is the best way for you to follow reproducing corals? you are a marine biologist. what is the b
    15·1 answer
  • What would happen to a plant cell placed in a solution of seawater
    11·1 answer
  • What happens to most of the sunlight that reaches earth?
    10·1 answer
  • There are a number of key enzymes that function in the replication of DNA. Using your book and other resources, identify what th
    12·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Giving 10 points away please help me with this question ASAP!!!!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!