1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleonysh [2.5K]
3 years ago
11

Why is complementary base pairing important in DNA structure?

Biology
1 answer:
Rudik [331]3 years ago
8 0
<span>A::T and G:::C is essential. The importance to the DNA structure is that prevents lose of genes and mis-formation of encoded products (protein and mRNA).</span>
You might be interested in
PLEASE HELP! ILL GIVE YOU A MEDAL AND FAN YOU!
Helga [31]
A cladogram is a type of graph that shows how closely related different types of organisms are in an evolutionary context. It resembles a tree, with various organisms being placed at the end of each branch. If two organisms have a close common branch, they are more closely related than those who have more distant branches. Since DNA, or corresponding protein sequences are more similar in closely related species, and more different in more distant species, a biologist can use those sequences to numerically determine how closely related three species are.
3 0
3 years ago
I need help with this
Kazeer [188]
Id say C. It makes the most sense to me.
7 0
3 years ago
Which of the following are lipids?
tresset_1 [31]
Waxes (option a) is correct
5 0
3 years ago
Read 2 more answers
When it was the last time the sakurajima volcano erupted?
NikAS [45]

Answer:

On September 13, 2016  ??

8 0
3 years ago
What kind of information is contained in chromosomes
Ulleksa [173]
Chromosomes keep dna which is what makes you look like you
4 0
3 years ago
Other questions:
  • Which of the following scenarios would provide the best evidence that human traits are a result of lifestyle choices...
    9·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Muscles are ______ and built up throughout life with new muscle tissue?
    11·1 answer
  • (NO LINKS)
    6·2 answers
  • Which TWO events happen in the rock cycle
    5·2 answers
  • 5.21 Unit Test: Water and Oceans - Part 1
    14·1 answer
  • Human red blood cells can live from two to four months without a nucleus, and yet they continue to synthesize hemoglobin. This G
    13·1 answer
  • Jorge is drawing an atomic model. The part of the atom that he has drawn is shown below. What does Jorge need to add to complete
    8·1 answer
  • GIVING BRAINLIEST!!!! PLS HELP!!!!!! ;-;
    15·2 answers
  • An attraction between substances of the same kind is called___while an attraction between different substances is called___
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!