All categories

3 years ago

Georgia has how many different types of registration periods

Biology

1 answer:

geniusboy [140]3 years ago

5 0

Answer:

Explanation:

Georgia has 12 different types of registration periods based on the first letter of the business name that will expire after 30 days in midnight.

The registration period are classified based on the month and the starting letter of business name as given below -

Business Name begins with Expiration Month

A or B for the month of January

C or D for the month of February

E, F, 4, 5, or 8 for the month of March

G or H for the month of April

I or J for the month of May

K or L for the month of June

M, N, or 9 for the month of July

O, P, or 1 for the month of August

Q or R for the month of September

S, T, 2, 3, 6, or 7 for the month of October

U, V, or W for the month of November

X, Y, Z or 0 for the month of December

You might be interested in

.In women, aging becomes a significant risk factor for heart disease after the age of:

Gennadij [26K]

Answer: option b - 55

Explanation:

Menopause signifies the time in a woman's life when menstruation ends, usually BETWEEN age 45 - 55.

And because of the crucial role played by Oestrogen in menstruation, its LOSS increases the RISK of HEART DISEASE seen in women AFTER MENOPAUSE .

8 0

3 years ago

Which question is scientifically testable allowing a conclusion to be made based on scientific evidence?

sineoko [7]

Answer: C) Is gold heavier than silver?

Explanation: .-.

4 0

3 years ago

Motor (efferent) neurons carry information _____ the brain whereas sensory (afferent) neurons carry information ______ the brain

Norma-Jean [14]

Neurons are the building blocks of the nervous system. They are the links so that information could be processed as electrochemical signals. There are three fundamental kinds of neurons in our body:

1. Motor neurons - they carry signals from the central nervous system (CNS) to the body parts such as muscle movement
2. Sensory neurons - they carry signals from other body parts to the CNS
3. Interneurons - interlinking neurons between the brain and the spinal cord

Thus, the correct and complete statement above should be

<span><em>Motor (efferent) neurons carry information </em><em>from </em><em>the brain whereas sensory (afferent) neurons carry information</em><em> to</em><em> the brain.</em></span>

5 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

What contracts to pump blood out of the heart?

OlgaM077 [116]

Left ventricular must be right answer

6 0

3 years ago

Read 2 more answers