1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alina1380 [7]
3 years ago
8

Based on figure 2-4 what is the mass number of carbon?? 20 points!!!! answer asap

Biology
2 answers:
Tema [17]3 years ago
7 0
Carbon has a mass of 12
sladkih [1.3K]3 years ago
6 0
The mass of carbon is 12 as the two 6s add up to 12, hope this is helpful!
You might be interested in
Biome with a salt water environment.<br> A. Estuary <br> B.Marine ​
erastovalidia [21]

Answer:

a

Explanation:

6 0
2 years ago
Read 2 more answers
Select the reasons why the term 'prokaryote' can be problematic.
miv72 [106K]

Answer:

__ It implies that prokaryotes existed before eukaryotes, and

__ It implies that eukaryotes evolved from prokaryotes.

Explanation:

The prefix pro- can mean "before". By using the term prokaryote one can tend to think that procaryotes preceded eukaryotes.

Preceed as existed before them, or as an evolutionary point of view.

5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
a word used to describe a characteristic of a hypothesis it means you are able to experiment to see how two variables may be rel
AnnyKZ [126]

When writing a hypothesis, you need to be able to say IF this, THEN this will happen.

3 0
3 years ago
Read 2 more answers
Which of the following exposure factors will produce the greatest receptor exposure?
earnstyle [38]

400 mA, 70 ms is the following exposure factors will produce the greatest receptor exposure.

C: 400 mA, 70 ms

<u>Explanation:</u>

As SID builds, the introduction rate diminishes and receptor presentation diminishes. SID and the mAs required to keep up the introduction to the IR have a straightforwardly corresponding relationship (as the SID builds, the mAs required to keep up presentation to the IR increments by a corresponding sum).

An expanded SID likewise decreases amplification (size twisting). The most extreme SID ought to be utilized when conceivable to limit amplification. Infrequently, however, the SID can be purposefully diminished for amplification. SID influences size yet not shape twisting.

3 0
3 years ago
Other questions:
  • Hello I` m Leonardo Favio
    8·1 answer
  • A cross is made between homozygous wild-type female Drosophila (a^+ a^+ b^+ b^+ c^+ c^+) and triple-mutant males (aa bb cc) (the
    12·1 answer
  • A forest has pine trees, along with oak trees and birch trees. All the trees provide shelter and food for different animals in t
    7·2 answers
  • How are the male penguin trying to attract gloria?
    5·2 answers
  • Anyone have this answer
    14·1 answer
  • "Within which structure does the placenta normally develop?
    5·1 answer
  • Which term describes the stage at which cohesins disappear and allow the centromeres to move apart in animal cells?
    10·1 answer
  • explain the relationship between structure and function for proteins include the term denaturation in your explanation name one
    9·1 answer
  • Which substance will a bacterium produce when a human gene is added to its genome?
    7·1 answer
  • How do antigens and antibodies interact? PLEASE HELP NO LINKS PLEASE
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!