1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lukranit [14]
3 years ago
15

Which of the following is not one of the four main layers on earth atmosphere

Biology
2 answers:
worty [1.4K]3 years ago
8 0

Answer:

C Methosphere

Explanation:

Google

vladimir2022 [97]3 years ago
3 0
I Think That Its D)exosphere
You might be interested in
The difference in the concentration of dissolved particles from one location to another is called a..,
Tema [17]

Answer:

<h2>Concentration Gradient </h2>

<h3>Hope it helps you </h3>

3 0
2 years ago
Microtubules are long,hollow protein cylinder that form a rigid skeleton for the cell
ivolga24 [154]
Microtubules are long,hollow protein cylinder that form a rigid skeleton for the cell golgi apparatus

~Jurgen
8 0
3 years ago
Which of the following represents an example of Mullerian mimicry?
Mumz [18]
<em>the correct option for this is B>></em>
5 0
3 years ago
Define population density as a<br> mathematical equation.
kvasek [131]

Answer:

The formula for calculating population density is Dp= N/A. In this equation, Dp is the density of population, N is the total population as a number of people, and A is the land area covered by that population.

Explanation:

a statistic that tells you how many people live in a certain area. ... density is reported in square miles or kilometers, and may or may not include bodies of water. This type of measurement is called arithmetic density, and is reported as the total number of people per land.

4 0
3 years ago
________ is/are a contractile ring of actin microfilaments that eventually results in the division of the cytoplasm.
sergey [27]
CONTRACTILE RINGS are a contractile ring of actin micro filaments that eventually results in the division of the cytoplasm.
The contractile ring are usually formed during the early anaphase phase of the cell division cycle. During the cellular cleavage, the contractile rings tighten around the cytoplasm of the cell until it is pinched into two daughter cells.
6 0
3 years ago
Other questions:
  • How are food webs and food chains similar? How are they different?
    12·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • How are dna and mrna alike
    5·2 answers
  • What metric unit would you use to measure the length of a paper clip?
    12·1 answer
  • A scientist observes that all people who contract a painful skin rash known as shingles have previously in their lifetime been i
    10·1 answer
  • A fly has two alleles for the color of its eyes. The green allele is recessive, and is represented by Q. The blue allele is domi
    14·2 answers
  • If a climatologist is looking at remains from animals and plants that lived millions of years ago to get information about the c
    11·2 answers
  • Pour chacun des changements d'état donnés, indique le nom du changement inverse.
    12·1 answer
  • Give one similarity between the cell theory and the theory of spontaneous generation.
    13·1 answer
  • What is the amino acid sequence of the DNA strand: TAC AAA GTT AGA GAG TAG ATC
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!