1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
3 years ago
9

How many birds are tested for west nile virus in florida

Biology
1 answer:
bearhunter [10]3 years ago
4 0
Based on the CDC Article There were about 300 species of birds infected by the west Nile virus in Florida. good luck:)
You might be interested in
Which food or drink item is a homogeneous mixture?
TiliK225 [7]

the correct answer would be C. Coffee is a homogenous mixture.

5 0
3 years ago
Read 2 more answers
Which of the following is not a function of carbohydrates?
IgorC [24]

Answer:

I believe it should be structure.

Explanation:

6 0
2 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Explain how body cells (somatic) and sex cells (gametes) are made up from chromosomes?
lana [24]

゚+*:ꔫ:*﹤  ﹥*:ꔫ:*+゚Answer:゚+*:ꔫ:*﹤  ﹥*:ꔫ:*+゚

Somatic cells are produced through the cell division process of mitosis. ... Cells with two copies of each chromosome are called diploid. Sperm and egg cells, called gametes, are formed through meiosis, which is a slightly different cell division process that results in the cells having only one copy of each chromosome.

゚+*:ꔫ:*﹤  ﹥*:ꔫ:*+゚Explanation:゚+*:ꔫ:*﹤  ﹥*:ꔫ:*+゚

Human body cells (somatic cells) have 46 chromosomes. A somatic cell contains two matched sets of chromosomes, a configuration known as diploid. ... Human cells that contain one set of 23 chromosomes are called gametes, or sex cells; these eggs and sperm are designated n, or haploid.

゚+*:ꔫ:*﹤  ﹥*:ꔫ:*+゚゚+*:ꔫ:*﹤  ﹥*:ꔫ:*+゚゚+*:ꔫ:*﹤  ﹥*:ꔫ:*+゚゚+

8 0
3 years ago
Which is the pathway of oxygen to the lungs
RideAnS [48]

Answer:

Pathway of air: nasal cavities (or oral cavity) > pharynx > trachea > primary bronchi (right & left) > secondary bronchi > tertiary bronchi > bronchioles > alveoli (site of gas exchange)

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • If hardy-weinberg conditions exist, what will happen to the frequency of a dominant allele over time? the frequency will increas
    9·2 answers
  • Explain the importance of mitochondria in eukaryotic cellular activity
    15·1 answer
  • What do scientist now think of the theory of vitalism
    8·1 answer
  • SOMEONE PLEASE HELP ASAP!! THANK YOU SO MUCH!!!
    8·1 answer
  • Use specific examples from Joseph Priestley’s experiment to explain the relationship between what he observed and what he inferr
    7·2 answers
  • The area of the brain involved with comprehension of speech is __________. A. Broca’s area B. Wernicke’s area C. the occipital l
    11·2 answers
  • Which nonmetallic, white mineral cleaves in one direction and feels greasy?
    6·1 answer
  • The electrostatic force that holds an ionic compound together like NaCI occur when
    5·1 answer
  • Which is true about water molecules?
    9·1 answer
  • A commensal bacterium?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!