1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
3 years ago
15

A nurse is caring for a patient who has been receiving a drug by the intramuscular route but will receive the drug orally after

discharge. how does the nurse explain
Biology
1 answer:
Murljashka [212]3 years ago
6 0
The nurse doesn't explain.
You might be interested in
what is meant by translocation? view available hint(s)for part f what is meant by translocation? the two ribosomal subunits are
Karo-lina-s [1.5K]

The ribosome slides one codon down the mRNA. <u> Option B.</u>

Transcription is the technique of the producing of RNA from DNA. Translation is the gadget of the formation of protein from RNA. Translocation is the motion of substances in vegetation from the leaves to other elements of the plant. Translation takes area at the ribosome, which includes rRNA and proteins. In translation, the instructions in mRNA are take a look at, and tRNA brings the perfect collection of amino acids to the ribosome.

Metabolic techniques, particularly the products of photosynthesis are transported from the leaves in which they may be formed to unique factors of the plant. This shipping of soluble photosynthetic products is known as translocation and takes vicinity in a part of the vascular tissue called the phloem. A mutation wherein non-homologous chromosomes change stretches of DNA. Autosomal issues. Autosomal troubles affect each women and men.

Learn more about Translocation here:-brainly.com/question/14464141

#SPJ4

6 0
1 year ago
Explain the term generation time
kotykmax [81]

Explanation:

Generation time is the time taken for a cell population to double in numbers and thus equivalent to the average length of the cell cycle.

5 0
3 years ago
(Last one)
noname [10]

that will be temperature cause the mass will either have to increase or decrease

6 0
3 years ago
Read 2 more answers
Which two cellular structures provide protection to the cell? A. nuclear membrane and vacuole B. cellular membrane and cell wall
arsen [322]

Hey there! Cellular membrane and cell wall is your answer.


7 0
3 years ago
Match the following terms and descriptions. 1. cloning most controversial method of genetic engineering 2. hybridization breedin
Savatey [412]

Correct matches of terms and its descriptions:

1. Cloning (most controversial method of genetic engineering)

2. hybridization ( breeding organisms because of beneficial traits)

3. recombinant ( DNA DNA from different biological sources that have been combined and culture)

4. selective breeding ( breeding two different species to make a new individual)

Selective breeding is also called artificial selection. Hybridization.is mating organisms of different species to create a hybrid.  Cloning produces similar copy of genetically identical individuals. 

3 0
4 years ago
Read 2 more answers
Other questions:
  • During a viral attack, which of the following is NOT the function of the host organism? A. To become a factory of viral producti
    7·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Ellen has eggs she wishes to trade for grain. However, she cannot find anyone with grain that needs eggs. What is missing for th
    8·1 answer
  • How do the respiratory and circulatory systems work together?
    12·1 answer
  • How many organelles are in both plant and animal cells?
    14·1 answer
  • Answer "true" if the following terms are correctly paired. Use a dictionary, if necessary. lobster--vertebrate paleontology
    14·2 answers
  • Which of the following is not a characteristic of a parenchyma cell?
    10·1 answer
  • Theme is the _____ or _____ about _____ that is communicated by a literary work.
    15·1 answer
  • Please fill in the blank to answer the question.
    5·2 answers
  • What does costal cartilage connect?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!