1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Greeley [361]
3 years ago
5

Heredity is best described as __________.

Biology
1 answer:
alisha [4.7K]3 years ago
7 0
Heredity has to do with characteristics that you were born with, and things that you cannnot learn. For example, eye, hair, skin, color. I say none of the above
You might be interested in
Could anyone help me please?
Anton [14]
The answer is d a mitochondrion
3 0
3 years ago
Personality assessments conducted by behaviorists sometimes make use of _______. (1 point) question 56 options: 1) projective te
pickupchik [31]

The right option is 5) rating scales and frequency counts

Personality assessment is the measurement of personal characteristics of an individual. Personality assessments conducted by behaviorists sometimes make use of rating scales and frequency counts as they allow easy characterization of people and their behaviour.






5 0
3 years ago
1. How could you test to see if an enzyme was completely depleted during an experiment?
pishuonlain [190]
To test, increase the amount of substrate. If the amount of reaction changes then the enzyme has not depleted. If the amount of reaction does not change then the enzyme has completely depleted.
6 0
3 years ago
The seeds of ___________ are protected in some type of fruit.<br>A.angiosperms<br>B.gymnosperms
Natalka [10]

Answer:

a

Explanation:

Because it mom said so.

5 0
3 years ago
The 31 major nerves that branch out from the spinal cord connecting it to the rest of the body are the
Cloud [144]
C. spinal nerves

it is the answer to your question.
5 0
3 years ago
Other questions:
  • Kristoff was recently diagnosed with depression after reporting symptoms such as a loss of interest in activities, poor concentr
    8·1 answer
  • What is the total amount of matter in an ecosystem doing
    6·1 answer
  • Biologists use the fluid mosaic model to describe membrane structure. Which statements about the fluid mosaic structure of a mem
    6·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is genetic drift? View Available Hint(s) What is genetic drift? The motion of continental plates over time The physical spl
    10·1 answer
  • Waste managers need more land to collect city garbage. What environmental parameters should city officials investigate before pu
    14·2 answers
  • How do the sizes of each population affect each other?
    6·1 answer
  • HELP its easy i think
    12·2 answers
  • 2. What social issues affected the problem or its solution in each of the stories?
    13·1 answer
  • The Iced Tea Debate:
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!