1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nata0808 [166]
3 years ago
6

An acid has which chemical in high abundance

Biology
1 answer:
11Alexandr11 [23.1K]3 years ago
4 0
Hyaluronic acid, <span>also called </span>hyaluronan.
You might be interested in
Leishmania is a protozoal parasite are transmitted by the bite of infected female sandflies. they are then phagocytized and live
qaws [65]

The answer is macrophages. They either actively invade these leukocytes or are phagocytosed, divide in the cells and cause lysis. The promastigotes that invade these leucocytes are transformed into amastigotes in the macrophages. These amastigotes continue attacking other healthy macrophages while others migrate to the mid gut.






8 0
3 years ago
Read 2 more answers
The water cycle is a biogeochemical cycle that is a closed system. Which of these sentences describes a viable stage that occurs
Vadim26 [7]

Answer:

hydrolysis

Explanation:

6 0
3 years ago
there are two tomato plantlets one of them is kept in an oxygen chamber with a light source and another is kept in sunlight. bot
dusya [7]

That the one with natrual sunlight is healthier than the other one

7 0
3 years ago
The brain's _____ nucleus regulates the body's circadian rhythms.
deff fn [24]
The brain's suprachiasmatic nucleus regulates the body's circadian rhythms. The suprachiasmatic nucleus is a minute region of the brain located in the hypothalamus above the optic chiasm, the circadian rhythm is the 24-hour cycle of organisms, related to sunlight and temperature.
4 0
3 years ago
What is work?
likoan [24]
I believe it’s A. Not sure though
4 0
3 years ago
Read 2 more answers
Other questions:
  • List the senses used when observing a person
    14·2 answers
  • A science student makes the following statement
    6·2 answers
  • In the ribosome what pairs with the codon?
    9·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Finding common metabolic pathways, such as the tricarboxylic acid (Krebs) cycle, in both prokaryotic and eukaryotic organisms is
    6·1 answer
  • Which of the following types of models is usually in the form of a drawing, graph, or equation?
    9·2 answers
  • 10 points and brainliest for the first to answer!
    6·2 answers
  • Why has the solar system model been extremely useful to people and in the field of science?
    8·2 answers
  • ________ is the condition that occurs when there is a lack of muscle coordination during voluntary movement. A. quadriplegia B.
    15·1 answer
  • Which of the following is a biotic factor in an ecosystem?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!