1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mamaluj [8]
3 years ago
10

What organisms are considered to be benthos?

Biology
1 answer:
Andrei [34K]3 years ago
5 0

Answer: Benthos are the flora and fauna found on the bottom, or in the bottom sediments, of a sea, lake, or other body of water.

Explanation:

So benthos would be considered multicellular organisms since they are plants and can produce its own food and take its own food from other resources.

You might be interested in
Which leukocytes release histamine during the inflammatory response?
wolverine [178]

your answer would be C. basophils

7 0
3 years ago
The specification of the anterior-posterior axis in Drosophila embryos is initially controlled by various gene products that are
mojhsa [17]

Answer:

It is possible to determine their functions and to identify the mechanism involved in their mode of inheritance  

Explanation:

Matrilineal inheritance refers to the inheritance of genes directly from the mother, it either through the inheritance of mitochondrial DNA or by the epigenetic mechanism of genomic imprinting (in the case above indicated, maternal imprinting). By mutating genes which are inherited from the mother it is possible to study their functions as well as their mode of inheritance. By using a reverse genetics approach, many maternal imprinted genes have recently been identified to be involved in embryo development, especially in model organisms like <em>Drosophila</em>.

8 0
3 years ago
27)
Ket [755]

Answer:

A) species with short reproductive cycles

6 0
3 years ago
Read 2 more answers
After asking a question, a scientist can form a(n) blank
Veronika [31]

Answer:

hypothesis

Explanation:

4 0
3 years ago
Read 2 more answers
In his attempt to develop a pneumonia vaccine, Frederick Griffith injected mice with various combinations of living and dead bac
n200080 [17]

Answer:

The mice died

Explanation:

In Griffith's experiment, two strains of the same bacteria were used. S strain was smooth because it had a polysaccharide coat. This coat also made it virulent because mouse immune system was not able to destroy it and ultimately the mice died. R strain was rough because it did not have the coat and thus was harmless to mice.

When Griffith injected mice with dead S bacteria and living R bacteria together, the mice died. Live R bacteria had taken up the genetic material or as Griffith called "transforming principle" from the dead S bacteria and transformed into S bacteria. So live S bacteria were present again and they killed the mice.

4 0
3 years ago
Other questions:
  • A. ATP is similar to DNA but it has 2 extra _____
    5·1 answer
  • How does the digestive system work with the nervous system?
    5·1 answer
  • true/false. The pacific northwest is home to a temperate rain forest, where over 300 centimeters of rain falls yearly
    10·1 answer
  • Out of the organisms listed, which are most closely related based on the characteristics listed.
    8·1 answer
  • Dr. amrit predicts that a certain drug will help patients with schizophrenia. her prediction is called _____. a conclusion empir
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Help meeeeeeeeeeeeeeee
    8·2 answers
  • Which part of the virus houses the nucleic acid?
    5·1 answer
  • 2. An example of an internal stimulus
    5·1 answer
  • ____________________ is a significant rise in extinction rates above the natural background rate.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!